Genomic Feature

a52

ID
ZDB-ALT-010731-9
Name
a52
Synonyms
  • perplexed (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Dowling Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 20: 38806634 (GRCz11) (1) Details
Nucleotide change
A/C
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>G (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Met>Arg at position 1283 (1)
Sequences
Flanking Sequence
TTGTTTAAATGCGTCAAATACATTGCCTATATTCACTGAGAAATGAATAAAGATATTCATTTTCAAAATGGGCTGTACTCAATTATGCTGAGCACTGTATAATTTATACTGCTGTTTTCTGGTGATTTCTTTTATCCTCATTTATTTTTGAGTCGCTTTGAATAAAAATCATCTGCTAAATGAATAAATGTAATTAAATTAAAAGTAGTCAAATCGTATGAGTTGAAATGAGTTAATTAGATTATGAATTATTAATCAAATTAATTGAAATAATCAAATCAGACAAATCAAACCAAGTTAATATGATTAGGAATTAAATTAAGAATTCAACTCTAGTGATTTTGTTCTAATGACTCATTCGACAGTCAATTATTACCTTGTAACTACCAATAGAGAGCAGAATGTTCTTTTTAGGGATCTTGAAGCCGGTGCTAAGCATGGCTTTGAGATAGGCCTCATATCGGTTCTCCCCGAAGCAGGCCACTTCTCCAGTGCTGGTC
A/C TCTCAACACCCAAAACCACATCTGCTCCAGCCAGGCGGGAGAAGGAGAACTGAGGAACCTGAGGGTAAAGCACAAATCACAGATTATTTAAGATCTTGTTCAGTTCGATTACTAGCATAAAAAAAAATTTCCATGAAGCTCATTACCTTAACTCCAACAATGCCATTCCCCCTCATCAGCCCAACAGCTTCCACTTCCTCTCCCAAGATGACTCTTGTTGCAAGCGCGACAAGATCCACACCAAGTGTTTTGGACACATAAGGGAAGGAGCGCGAGACTCGCACATTGCACTCGATCACCTTCAGCTGATCATCCTGTAGACAGACACACATATTAGGCTATGATTATACTAGAGCTTTTTTTTATTTTATTTTTTTTATACAAGTCTGTTTTGTTTGGCAGCCAGATTACTCAGACATTTTAACTTTTAAAAAAAGCAACTTGAGACCCTGTTTTAGATAAGAAGCTCCAGCGATACATTTTATCGTAGCTATCCCAAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations