| ZFIN ID: ZDB-SSLP-980528-781 |
| SSLP: | z6880 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 5 | 67.9 cM | z6880 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 5 | 279.59 cR | Z6880 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 5 | 5451.0 cR | z6880 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 5 | 106.6 cM | z6880 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z14143 | SSLP | 5 | Grosser et al., 2002 | Grosser, et al. (2002. Proc Natl Acad Sci, pre-published) report mapping ptgs1 to LG05 between z6880 and z14143 on the T51 mapping panel. | |
| ptgs1 | GENE | 5 | Grosser et al., 2002 | Grosser, et al. (2002. Proc Natl Acad Sci, pre-published) report mapping ptgs1 to LG05 between z6880 and z14143 on the T51 mapping panel. | |
| krt1-c5 | GENE | 5 | Padhi et al., 2006 | Padhi BK et al (Gene 368, 37-45) mapped the krt1-c5 gene to LG 5 near z6880. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| IND | 133,0,127 | 60.0 | |
| Forward Primer | TTGAAATGTCACCGTTGCAT | ||
| Reverse Primer | ATCATCAGCATGGTGCTCAA | ||
| AB | 0,151 | 60.0 | |
| Forward Primer | TTGAAATGTCACCGTTGCAT | ||
| Reverse Primer | ATCATCAGCATGGTGCTCAA | ||
| TU | 0,153 | 60.0 | |
| Forward Primer | TTGAAATGTCACCGTTGCAT | ||
| Reverse Primer | ATCATCAGCATGGTGCTCAA | ||
| EKW | 0,169 | 60.0 | |
| Forward Primer | TTGAAATGTCACCGTTGCAT | ||
| Reverse Primer | ATCATCAGCATGGTGCTCAA |