Community Action Needed: Please respond to the NIH RFI
ZFIN ID: ZDB-SSLP-980528-501

Mapping Details

SSLP: z4421
PHYSICAL MAP AND BROWSER No data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
23 34.0 cM z4421 Boston MGH Cross (MGH) Fishman, Mark C. Data
23 108.8 cM z4421 Mother of Pearl (MOP) Postlethwait, John H. Data
23 280.17 cR Z4421 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
23 4212.0 cR z4421 Goodfellow T51 (T51) Geisler, Robert Data
23 89.4 cM z4421 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
st48 Feature 23 Lyons et al., 2005 Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb3b to LG23 using bulk segregant analysis.
st14 Feature 23 Lyons et al., 2005 Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb3b to LG23 using bulk segregant analysis.
z6142 SSLP 23 Lyons et al., 2005 Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb3b to LG23 using bulk segregant analysis.
z14967 SSLP 23 Roman et al., 2002 Roman, et al. (2002. Dev 129:3009-3019.) report mapping acvrl1 to a 1 cM meiotic interval between z14967 and z4421 on LG23. Finer mapping places the gene in a 0.035 cM interval between SNP b82sp6 and the tarama gene. That gap was spanned by two BACs (BAC177k23 and BAC157p19).
acvr1ba GENE 23 Roman et al., 2002 Roman, et al. (2002. Dev 129:3009-3019.) report mapping acvrl1 to a 1 cM meiotic interval between z14967 and z4421 on LG23. Finer mapping places the gene in a 0.035 cM interval between SNP b82sp6 and the tarama gene. That gap was spanned by two BACs (BAC177k23 and BAC157p19).
acvrl1 GENE 23 Roman et al., 2002 Roman, et al. (2002. Dev 129:3009-3019.) report mapping acvrl1 to a 1 cM meiotic interval between z14967 and z4421 on LG23. Finer mapping places the gene in a 0.035 cM interval between SNP b82sp6 and the tarama gene. That gap was spanned by two BACs (BAC177k23 and BAC157p19).
neurod4 GENE 23 Wang et al., 2003 Using the T51 RH panel, Wang et al. (2003) Dev Dyn : 227:(4) mapped neurod4  ...
j1607cTg Feature 23 ZIRC and ZFIN staff

OTHER MAPPING INFORMATION
Chr 23 Roman et al., 2002 Roman, et al. (2002. Dev 129:3009-3019.) report mapping acvrl1 to a 1 cM meiotic interval  ...
Chr 23 Wang et al., 2003 Using the T51 RH panel, Wang et al. (2003) Dev Dyn : 227:(4) mapped neurod4 ("zath3") to a region  ...
Chr 23 Lyons et al., 2005 Lyons et al.(2005, Curr. Biol. 15(6):513-524) mapped erbb3b to LG23 using bulk segregant  ...
Chr 23 ZIRC and ZFIN staff
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
IND NA
Forward Primer TACTAATGGCCCAGGGCGAG
Reverse Primer ACACCCTCCTTCACACCGGA
AB NA
Forward Primer TACTAATGGCCCAGGGCGAG
Reverse Primer ACACCCTCCTTCACACCGGA