| ZFIN ID: ZDB-SSLP-980528-420 |
| SSLP: | z3804 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 5 | 64.4 cM | z3804 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 5 | 212.5 cM | z3804 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 5 | 260.84 cR | Z3804 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 5 | 4889.0 cR | z3804 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 5 | 96.6 cM | z3804 | Heat Shock (HS) | Woods, Ian G. | Data |
| 5 | 97.57 cM | Gates et al (GAT) | Talbot, William S. | Data | |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| z51132 | SSLP | 5 | Meder et al., 2009 | Meder et al. (2009, Circ. Res. 104(5): 650-659) mapped lazm647 | |
| m647 | Feature | 5 | Meder et al., 2009 | Meder et al. (2009, Circ. Res. 104(5): 650-659) mapped lazm647 | |
| cmlc1 | GENE | 5 | Meder et al., 2009 | Meder et al. (2009, Circ. Res. 104(5): 650-659) mapped lazm647 |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| IND | NA | ||
| Forward Primer | CACGTGCTCAGAGCTCCAGC | ||
| Reverse Primer | GTGAAGCGCGTGCACATAGG | ||
| AB | NA | ||
| Forward Primer | CACGTGCTCAGAGCTCCAGC | ||
| Reverse Primer | GTGAAGCGCGTGCACATAGG |