Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
7	60.7 cM	z20576	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
7	235.95 cR	Z20576	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
7	5251.0 cR	z20576	Goodfellow T51 (T51)	Geisler, Robert	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z1239	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1713	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1798	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z3008	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z5467	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z6483	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z7958	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8156	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8218	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z14401	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z20715	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1239	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z3008	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z3445	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z6852	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z7244	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z7958	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8156	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8218	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z26442	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z14401	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z13880	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
fc89b01	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z14644	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8252	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z13880	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fa11d03	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8540	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fb64f09	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1059	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
fb64c10	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8252	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fgf3	GENE	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fi19d09	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
dtv43	Feature	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z8604	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z9869	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1059	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z11122	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z11625	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z8604	SSLP	7	1.7 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
fb12g02	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
fd21a02	EST	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z1182	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z1182	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.
z9869	SSLP	7	0.8 cM	McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped the centromere of LG 7 using a mitoic map constructed from half-tetrad analysis of 125 fish. z7958 and z9869 correspond to the centromere.
z11625	SSLP	7		McFarland et al., 2005	McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.

OTHER MAPPING INFORMATION

Chr 7 McFarland et al., 2005 McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map  ... McFarland et al. (2005, Developmental Dynamics 233:390-406) mapped LG 7 using a mitoic map constructed from 2916 haploid fish.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
AB	120,106		60.0
Forward Primer	CATCCAGTGAGTCTCAGGCA
Reverse Primer	GGGCAATAGGGCTGAACATA
IND	0,96		60.0
Forward Primer	CATCCAGTGAGTCTCAGGCA
Reverse Primer	GGGCAATAGGGCTGAACATA
EKW	120,106		60.0
Forward Primer	CATCCAGTGAGTCTCAGGCA
Reverse Primer	GGGCAATAGGGCTGAACATA
TU	122,0,116,96		60.0
Forward Primer	CATCCAGTGAGTCTCAGGCA
Reverse Primer	GGGCAATAGGGCTGAACATA