| ZFIN ID: ZDB-SSLP-980528-1507 |
| SSLP: | z11341 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 17 | 45.1 cM | z11341 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 17 | 275.08 cR | Z11341 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 17 | 3035.0 cR | z11341 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| disp2 | GENE | 17 | Nakano et al., 2004 | Nakano et al. (2004, Dev. Biol. 269(2):381-392) mapped disp2 to LG17 close to z11341 and wz5785 on TN51 RH panel. | |
| z4332 | SSLP | 17 | 1.32 cM | Wei et al., 2002 | Wei and Malicki (2002. Nat Genet 31:150-157.) report mapping nok to LG17 between z11341 and z4332 using half-tetrad analysis and a high resolution F2 mapping panel. A chromosome walk using BAC and PAC clones identified a 55kb region containing nok and was then sequenced. nok is approximately 0.12cM from z11431 and 1.2cM from z4332. |
| pals1a | GENE | 17 | 0.12 cM | Wei et al., 2002 | Wei and Malicki (2002. Nat Genet 31:150-157.) report mapping nok to LG17 between z11341 and z4332 using half-tetrad analysis and a high resolution F2 mapping panel. A chromosome walk using BAC and PAC clones identified a 55kb region containing nok and was then sequenced. nok is approximately 0.12cM from z11431 and 1.2cM from z4332. |
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 0,253 | 60.0 | |
| Forward Primer | TCTCCAGAAATGCTGCTCCT | ||
| Reverse Primer | GCTGGATCTCATGGGAGGTA | ||
| IND | 0,225 | 60.0 | |
| Forward Primer | TCTCCAGAAATGCTGCTCCT | ||
| Reverse Primer | GCTGGATCTCATGGGAGGTA | ||
| TU | 0,217 | 60.0 | |
| Forward Primer | TCTCCAGAAATGCTGCTCCT | ||
| Reverse Primer | GCTGGATCTCATGGGAGGTA | ||
| EKW | 0,253 | 60.0 | |
| Forward Primer | TCTCCAGAAATGCTGCTCCT | ||
| Reverse Primer | GCTGGATCTCATGGGAGGTA |