Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
3	54.0 cM	z10805	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
3	186.73 cR	Z10805	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
3	2267.0 cR	z10805	Goodfellow T51 (T51)	Geisler, Robert	Data
3	46.5 cM	z10805	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
b1189	Feature	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
xylt1	GENE	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
z963	SSLP	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
z5197	SSLP	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
z59609	SSLP	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
b1128	Feature	3		Eames et al., 2011	Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.
col1a1a	GENE	3		Fisher et al., 2003	Fisher S et al. (Dev. Biol. 264, 64-76) mapped the col1a1 gene to LG 3 between  ... Fisher S et al. (Dev. Biol. 264, 64-76) mapped the col1a1 gene to LG 3 between Z1140 and Z10805 near Z9257 and cdc27.
z1140	SSLP	3		Fisher et al., 2003	Fisher S et al. (Dev. Biol. 264, 64-76) mapped the col1a1 gene to LG 3 between  ... Fisher S et al. (Dev. Biol. 264, 64-76) mapped the col1a1 gene to LG 3 between Z1140 and Z10805 near Z9257 and cdc27.
z9257	SSLP	3		Fisher et al., 2003	Fisher S et al. (Dev. Biol. 264, 64-76) mapped the col1a1 gene to LG 3 between  ... Fisher S et al. (Dev. Biol. 264, 64-76) mapped the col1a1 gene to LG 3 between Z1140 and Z10805 near Z9257 and cdc27.
cdc27	GENE	3		Fisher et al., 2003	Fisher S et al. (Dev. Biol. 264, 64-76) mapped the col1a1 gene to LG 3 between  ... Fisher S et al. (Dev. Biol. 264, 64-76) mapped the col1a1 gene to LG 3 between Z1140 and Z10805 near Z9257 and cdc27.
z20966	SSLP	3		Gleason et al., 2004	Gleason et al. (2004.Dev. Biol. 276:441-451) reports mapping acc to LG3  ... Gleason et al. (2004.Dev. Biol. 276:441-451) reports mapping acc to LG3 between fc25e04 and Z20966.
fc25e04	EST	3		Gleason et al., 2004	Gleason et al. (2004.Dev. Biol. 276:441-451) reports mapping acc to LG3  ... Gleason et al. (2004.Dev. Biol. 276:441-451) reports mapping acc to LG3 between fc25e04 and Z20966.
tq206	Feature	3	1.4 cM	Gleason et al., 2004	Gleason et al. (2004.Dev. Biol. 276:441-451) reports mapping acc to LG3  ... Gleason et al. (2004.Dev. Biol. 276:441-451) reports mapping acc to LG3 between fc25e04 and Z20966.
z63912	SSLP	3		Pathak et al., 2007
ift70	GENE	3	0.17 cM	Pathak et al., 2007

OTHER MAPPING INFORMATION

Chr 3 Fisher et al., 2003 Fisher S et al. (Dev. Biol. 264, 64-76) mapped the col1a1 gene to LG 3 between Z1140 and Z10805  ... Fisher S et al. (Dev. Biol. 264, 64-76) mapped the col1a1 gene to LG 3 between Z1140 and Z10805 near Z9257 and cdc27.   Chr 3 Eames et al., 2011 Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the  ... Eames, et al. (2011. PLoS Genet. 7(8):e1002246.) reports mapping alleles b1128 and b1189 to the zylt1 gene on LG3, using markers Z5197, z59609, Z10805 and Z963.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
AB	0,233		60.0
Forward Primer	GCCACCTAAAGCACTTTCCA
Reverse Primer	CTTGTTGGCTCACTTTTGCA
IND	0,215		60.0
Forward Primer	GCCACCTAAAGCACTTTCCA
Reverse Primer	CTTGTTGGCTCACTTTTGCA
EKW	233,211		60.0
Forward Primer	GCCACCTAAAGCACTTTCCA
Reverse Primer	CTTGTTGGCTCACTTTTGCA
TU	0,211		60.0
Forward Primer	GCCACCTAAAGCACTTTCCA
Reverse Primer	CTTGTTGGCTCACTTTTGCA