header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-SSLP-980528-1312

Mapping Details

SSLP: z9944
PHYSICAL MAP AND BROWSERNo data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
2 40.6cM z9944 Boston MGH Cross (MGH) Fishman, Mark C. Data
2 273.05cR Z9944 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
2 2341.0cR z9944 Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
ptgs2a GENE 2 Grosser et al., 2002 Grosser, et al. (2002. Proc Natl Acad Sci, pre-published) report mapping ptgs2 to LG02 between z6569 and z9944 on the T51 mapping panel.
z6569 SSLP 2 Grosser et al., 2002 Grosser, et al. (2002. Proc Natl Acad Sci, pre-published) report mapping ptgs2 to LG02 between z6569 and z9944 on the T51 mapping panel.

OTHER MAPPING INFORMATION
Chr 2 Grosser et al., 2002 Grosser, et al. (2002. Proc Natl Acad Sci, pre-published) report mapping ptgs2 to LG02  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
AB 0,223 60.0
Forward Primer TGGATCACTTGCGATAACCA
Reverse Primer AATCCCTATACGGCACCTCA
IND 0,243 60.0
Forward Primer TGGATCACTTGCGATAACCA
Reverse Primer AATCCCTATACGGCACCTCA
EKW 0,219 60.0
Forward Primer TGGATCACTTGCGATAACCA
Reverse Primer AATCCCTATACGGCACCTCA
TU 203 60.0
Forward Primer TGGATCACTTGCGATAACCA
Reverse Primer AATCCCTATACGGCACCTCA