| ZFIN ID: ZDB-SSLP-980528-1124 |
| SSLP: | z9057 |
|---|
PHYSICAL MAP AND BROWSER
No data available
PHYSICAL MAPPING
No data available
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 14 | 52.5 cM | z9057 | Boston MGH Cross (MGH) | Fishman, Mark C. | Data |
| 14 | 3723.0 cR | z9057 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| dty40 | Feature | 14 | 3.1 cM | Kramer et al., 2002 | Kramer et al. (2002. Developmental Biology 250:263-279) report mapping the allele sbndty40 to LG14 approximately 3.1 cM from SSLP z9057. They also report that sbndty40 is less then 0.1 cM from madh5. |
| smad5 | GENE | 14 | Kramer et al., 2002 | Kramer et al. (2002. Developmental Biology 250:263-279) report mapping the allele sbndty40 to LG14 approximately 3.1 cM from SSLP z9057. They also report that sbndty40 is less then 0.1 cM from madh5. |
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| AB | 150 | 60.0 | |
| Forward Primer | CAGAAACATTCCATGTGCCA | ||
| Reverse Primer | TCCACCCATTTGGCATATCT | ||
| IND | 0,214 | 60.0 | |
| Forward Primer | CAGAAACATTCCATGTGCCA | ||
| Reverse Primer | TCCACCCATTTGGCATATCT | ||
| EKW | 0,216,148 | 60.0 | |
| Forward Primer | CAGAAACATTCCATGTGCCA | ||
| Reverse Primer | TCCACCCATTTGGCATATCT | ||
| TU | 150,204,144 | 60.0 | |
| Forward Primer | CAGAAACATTCCATGTGCCA | ||
| Reverse Primer | TCCACCCATTTGGCATATCT |