Community Action Needed: Please respond to the NIH RFI
Genomic Feature

dty40

ID
ZDB-ALT-980203-1265
Name
dty40
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
This allele contains an Asp(447)-> Glu exchange caused by a GAT->GAA mutation. This Asp residue is conserved in all members of the Smad family. This mutation has a strong hypomorphic and weak antimorphic effect.
This allele contains an Asp(447)-> Glu exchange caused by a GAT->GAA mutation. This Asp residue is conserved in all members of the Smad family. This mutation has a strong hypomorphic and weak antimorphic effect.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 14: 26467826 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
This allele contains an Asp(447)-> Glu exchange caused by a GAT->GAA mutation.  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Asp>Glu at position 447 (1)
Sequences
Flanking Sequence
GCCTTGCGAATAACAGGATTAGACAACATAGCAATTAAAAAGATTCTCATAAAACTAGGAAACTGCAATTGCATTTTTCAACTGGTGTAAAGTGAAGTAGAGATACATGAAAGCATGTCAATGTCATCTACTAGATTACCTACAGTTAGAGAAAATCAGTCATACAAGCATCATTGTAAAACAACTGTATGCAAAAAAACAACAAAACAAAACATGAAGTCAATTGCTAAAGCAGTAGTTAGTCCATTTTGTGTCACTGCCTAGAATTTTCCTATGCTAGATGTGCTTGTAGCCCCAGTTCATCTTCTCGTTCTGACTGCTGCAGGATTTGGTGGCATTCTCCAGGTTGTGTAAACAGTTCAGCCCTTAAGACCTCCTATTCTTTCAAAAGTGAAGAAAGAAAATAAGAAGAAGAAAACAAAGGCTCCTCCCAGGTCAGCCCATCATTACGAGACAGAAGAGATGGGGTTCAGAGGGGAACCCATTTGTGTTAGAACTTT
A/T TCCAGCCATTGCAGGGGGCCGTGGAGATGCACTTCTATCCAGCAGGGGGTGCTTGTCACATCTTGTCTGTGGTACTCGGCACCCCAACCCTTGAATAGAAAGAAATAAAGAAAAAAGTTGAAGATTAAACATGGATGGATGGAATTATATTCATATCACTTGGTTCTTGATCTAAAACTCAGAGCAACAAGTGTATATTACTAATAATAAATCAATTGACTGATTATTTTATTATATTTTTTCTGAATTTGTACTTCTAATGTTAAGATAAAAATCATTGAAAAGTCTGACGATAAAACATTTTTAAAAGCAAAGGAAAGTAAACATTTACAACATCAATAGTCATTTTTGGTGTTGCTAATAAAAATAGTTGTATTCGACCTTAATTTACACTAGTAAGTTGAATATTACAGTTTACTGTGGCCACAATGTCACTATCAGCCAAAAAAGATACATAAAGATGCATTTGCACATGACACTTATTTGCAAACAATTCCAAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
dty40.pdf
Citations