ZFIN ID: ZDB-GENE-980526-558

Mapping Details

Gene Name: WT1 transcription factor a
Symbol: wt1a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 25 15,178,225 - 15,214,161 GRCz11
Ensembl 25 15,178,225 - 15,214,161 GRCz11
Vega 25 15,081,825 - 15,117,761 GRCv10
NCBI Map Viewer 25 15,178,225 - 15,214,048 GRCz11
UCSC 25 - GRCv10
Mapped Clones containing wt1a
DKEY-114A13 Chr: 25 Details
CH73-152I22 Chr: 25 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa17769 25 15,178,814 GRCz11 Busch-Nentwich et al., 2013
25 15,082,414 GRCz10 Busch-Nentwich et al., 2013
25 15,535,870 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
25 80.3 cM wt1 Mother of Pearl (MOP) Postlethwait, John H. Data
25 207.86 cR WT1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
25 35.0 cM wt1 Heat Shock (HS) Woods, Ian G. Data
25 37.63 cM wt1 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 726 36.0
Forward Primer GCCTAGCCTGCTGTGTTATCCTT
Reverse Primer CTGGTGTCGTTTTAGCTGGTCTGA