ZFIN ID: ZDB-GENE-980526-526

Mapping Details

Gene Name: wingless-type MMTV integration site family, member 1
Symbol: wnt1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 23 27,652,906 - 27,658,054 GRCz11
Ensembl 23 27,652,906 - 27,658,054 GRCz11
Vega 23 27,726,365 - 27,731,513 GRCv10
NCBI Map Viewer 23 27,651,609 - 27,658,376 GRCz11
UCSC 23 - GRCv10
Mapped Clones containing wnt1
DKEY-166N8 Chr: 23 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa24353 23 27,654,925 GRCz11 Busch-Nentwich et al., 2013
23 27,728,384 GRCz10 Busch-Nentwich et al., 2013
23 27,895,562 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
23 111.3 cM wnt1 Mother of Pearl (MOP) Postlethwait, John H. Data
23 282.89 cR wnt1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
23 4234.0 cR wnt1 Goodfellow T51 (T51) Geisler, Robert Data
23 89.4 cM wnt1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 1700,2200 36.0
Forward Primer TGACCAACCTGCACAACAAT
Reverse Primer ATCCCGAGATGAAGGGAGTT