ZFIN ID: ZDB-GENE-980526-487

ZFIN ID: ZDB-GENE-980526-487

Mapping Details

Gene Name:	complement factor B
Symbol:	cfb

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	21	30,465,934 - 30,481,310	GRCz12tu
NCBI Map Viewer	21	30,465,934 - 30,481,310	GRCz12tu
Ensembl	21	27,416,284 - 27,431,397	GRCz11
NCBI Map Viewer	21	27,416,291 - 27,431,397	GRCz11
UCSC	21	-	GRCz11
Vega	21	27,379,589 - 27,394,702	GRCv10

Mapped Clones containing cfb
DKEY-197A18	Chr: 21 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sa1866	21	30,476,250	GRCz12tu	DIRECT		Sealy et al., 2025
	21	27,426,555	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	21	27,389,860	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	21	26,820,949	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa14271	21	30,467,756	GRCz12tu	DIRECT		Sealy et al., 2025
	21	27,418,124	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	21	27,381,429	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	21	26,812,518	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa23958	21	30,466,334	GRCz12tu	DIRECT		Sealy et al., 2025
	21	27,416,691	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	21	27,379,996	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	21	26,811,085	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa29609	21	30,476,000	GRCz12tu	DIRECT		Sealy et al., 2025
	21	27,426,307	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	21	27,389,612	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	21	26,820,701	Zv9	DIRECT		Busch-Nentwich et al., 2013
sa1866	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	21		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
sa14271	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	21		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
sa23958	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	21		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
sa29609	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	21		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneLinkage
	21		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
21	82.5 cM	bf	Mother of Pearl (MOP)	Postlethwait, John H.	Data
21	190.79 cR	bf	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
21	4092.0 cR	bf	Goodfellow T51 (T51)	Geisler, Robert	Data
21	81.1 cM	bf	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
gng3	GENE	21	10.76 cR	Kelly et al., 2001	Kelly et al. (2001., Int. J. Devl. Neuroscience 19:455-467) report mapping gng3 to LG21 aproximatly 10.76 cR from the gene bf on the LN45 mapping panel.

Primer Sets:
Strain	Bandsize	Annealing Temperature [C]
SJD	259	36.0
Forward Primer	TATGGCCGACTGATTCAGATTGGT
Reverse Primer	TCCATGCTATTTAGCCAGTCTTTT