ZFIN ID: ZDB-GENE-980526-362

Mapping Details

Gene Name: catenin (cadherin-associated protein), beta 1
Symbol: ctnnb1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 16 6,182,501 - 6,205,790 GRCz11
Ensembl 16 6,182,501 - 6,205,790 GRCz11
Vega 16 6,281,340 - 6,304,825 GRCv10
NCBI Map Viewer 16 6,182,500 - 6,205,822 GRCz11
UCSC 16 - GRCv10
Mapped Clones containing ctnnb1
CH73-49B13 Chr: 16 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa11589 16 6,192,788 GRCz11 Busch-Nentwich et al., 2013
16 6,291,620 GRCz10 Busch-Nentwich et al., 2013
16 7,445,782 Zv9 Busch-Nentwich et al., 2013
la019872Tg 16 7,458,556 - 7,458,566 Zv9

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
16 42.2 cM ctnnb Mother of Pearl (MOP) Postlethwait, John H. Data
16 75.35 cR IBD2058 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
16 17.6 cM ctnnb Heat Shock (HS) Woods, Ian G. Data
16 14.58 cM ctnnb Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by ctnnb1
fb73e10 Chr: 16 Details
fi81c06 Chr: 16 Details
fk25h01 Chr: 16 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 829 36.0
Forward Primer CAATCAGCTGGCCTGGTTT
Reverse Primer GCCAAGTCTCCAACCAACAA