Mapping Details

Genome Browser Chr Position Assembly ZFIN JBrowse 2 16,780,643 - 16,792,188 GRCz11 Ensembl 2 16,780,643 - 16,792,188 GRCz11 Vega 2 17,112,053 - 17,123,598 GRCv10 NCBI Map Viewer 2 16,780,634 - 16,792,177 GRCz11 UCSC 2 - GRCv10 UCSC 2 - GRCv10

Mapped Clones containing tfa
DKEY-263H23	Chr: 19 Details
CH73-211A15	Chr: 2 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
2	77.0 cM	tfa	Mother of Pearl (MOP)	Postlethwait, John H.	Data
2	203.87 cR	tfa	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
2	2024.0 cR	tfa	Goodfellow T51 (T51)	Geisler, Robert	Data
2	37.69 cM	tfa	Gates et al (GAT)	Talbot, William S.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION

Markers Encoded by tfa
fb62h02 Chr: 2 Details
IMAGE:3815706 Chr: 2 Details

Genomic Feature tzhe067 is an allele of tfa

Marker Type Chr Distance Publication / Person Comments z9354 SSLP 2 Fraenkel et al., 2009 Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant  ... Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant mapping. Intermediate resolution mapping with a panel of 88 mutant embryos identified flanking microsatellite markers z9354, z26250, and z4300.   z4300 SSLP 2 Fraenkel et al., 2009 Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant  ... Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant mapping. Intermediate resolution mapping with a panel of 88 mutant embryos identified flanking microsatellite markers z9354, z26250, and z4300.   z26250 SSLP 2 Fraenkel et al., 2009 Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant  ... Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant mapping. Intermediate resolution mapping with a panel of 88 mutant embryos identified flanking microsatellite markers z9354, z26250, and z4300.

Genomic Feature tzhe067 is an allele of tfa
Chr 2 Fraenkel et al., 2009 Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant mapping. Intermediate  ... Fraenkel et al (2009)localized tzhe067 to chromosome 2 using bulk segregant mapping. Intermediate resolution mapping with a panel of 88 mutant embryos identified flanking microsatellite markers z9354, z26250, and z4300.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	167		36.0
Forward Primer	CGATATGATTGAGAGGACCTACAA
Reverse Primer	TCATTTCATCCCCTTTTGTGATA