header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-GENE-980526-285

Mapping Details

Gene Name: cathepsin Lb
Symbol: ctslb
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 12 16,691,584 - 16,694,092
Ensembl 12 16,691,584 - 16,694,092
Vega 12 16,595,994 - 16,598,560
Vega 12 16,495,264 - 16,497,883
Vega 12 16,569,710 - 16,572,218
Mapped Clones containing ctslb
DKEY-239J18 Chr: 12 Details
DKEY-269I1 Chr: 12 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa22068 12 16,617,977 GRCz11 Busch-Nentwich et al., 2013
12 16,496,103 GRCz10 Busch-Nentwich et al., 2013
12 17,684,929 Zv9 Busch-Nentwich et al., 2013
sa27926 12 16,692,662 GRCz11 Busch-Nentwich et al., 2013
12 16,570,788 GRCz10 Busch-Nentwich et al., 2013
12 17,759,614 Zv9 Busch-Nentwich et al., 2013
sa44754 12 16,618,407 GRCz11 Busch-Nentwich et al., 2013
12 16,496,533 GRCz10 Busch-Nentwich et al., 2013
12 17,685,359 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
12 184.44 cR hgg1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
12 2034.0 cR hgg1 Goodfellow T51 (T51) Geisler, Robert Data
12 48.9 cM hgg1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by ctslb
fb30g09 Chr: 12 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 278 HaeIII 36.0
Forward Primer GCTACATCTACATGGCAAAAGAC
Reverse Primer GCAGGTCAAATAGATCCAGTACA