header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-GENE-980526-212

Mapping Details

Gene Name: distal-less homeobox 2a
Symbol: dlx2a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
NCBI Map Viewer 9 3,397,407 - 3,400,729
Mapped Clones containing dlx2a
CH211-245G15 Chr: 9 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa11175 9 3,400,387 GRCz11 Busch-Nentwich et al., 2013
9 3,428,858 GRCz10 Busch-Nentwich et al., 2013
9 3,396,837 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
9 7.5 cM dlx2 Mother of Pearl (MOP) Postlethwait, John H. Data
9 163.03 cR dlx2 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
9 0.0 cM dlx2 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 713 Tsp509I 36.0
Forward Primer AGCCACCACTTCATCACAAT
Reverse Primer AGATGTTCATTCGGCTTTCA