| ZFIN ID: ZDB-GENE-980526-330 |
| Gene Name: | caudal type homeobox 4 |
|---|---|
| Symbol: | cdx4 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing cdx4 | |
|---|---|
| CH211-231B5 | Chr: 14 Details |
| CH211-276G21 | Chr: 14 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| ch107 | 14 | 32,965,088 | GRCz11 | DIRECT | Rocha et al., 2021 | |
| hi2092Tg | 14 | 32,964,321 - 32,964,322 | GRCz11 | DIRECT | ZFIN Curated Data | |
| hi2188aTg | 14 | 32,964,452 - 32,964,453 | GRCz11 | DIRECT | ZFIN Curated Data | |
| ch107 | 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 14 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| hi2092Tg | 14 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| hi2188aTg | 14 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| hi2617Tg | 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | ||
| 14 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| tl240a | 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 14 | GRCz11 | OTHER_MAPPING | directMappedMarker | |||
| 14 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 14 | GRCz11 | OTHER_MAPPING | paneledMarkersDirect | |||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| tv205c | 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 14 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 5 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 14 | GRCz11 | OTHER_MAPPING | linkagesDirectMem2 | |||
| 14 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| 14 | GRCz11 | OTHER_MAPPING | linkagesDirectMem1 |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 14 | 117.4 cM | cad1 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 14 | 84.5 cM | cad1 | Heat Shock (HS) | Woods, Ian G. | Data |
| 14 | 71.88 cM | cad1 | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
|
| Markers Encoded by cdx4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| zk14a10.t7 Chr: 5 Details | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic Feature tl240a is an allele of cdx4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genomic Feature tv205c is an allele of cdx4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 271 | 36.0 | |
| Forward Primer | AGGCAAGCATGTATCACCAAGGAG | ||
| Reverse Primer | TAATCGGGCGAGCAATAGGAAACT |
| Genomic Feature tv205c is an allele of cdx4 |
Your Input Welcome
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if
additional information is required.
Oops. Something went wrong. Please try again later.