ZFIN ID: ZDB-GENE-980526-320

ZFIN ID: ZDB-GENE-980526-320

Mapping Details

Gene Name:	early growth response 1
Symbol:	egr1

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	14	25,651,454 - 25,653,695	GRCz12tu
NCBI Map Viewer	14	25,651,454 - 25,653,695	GRCz12tu
Ensembl	14	21,332,522 - 21,336,385	GRCz11
NCBI Map Viewer	14	21,333,720 - 21,335,961	GRCz11
UCSC	14	-	GRCz11
Vega	14	21,035,277 - 21,039,140	GRCv10

Mapped Clones containing egr1
CH211-119C17	Chr: 14 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	Citations
ihb1012	14	25,653,624 - 25,653,625	GRCz12tu	DIRECT	He et al., 2025
ihb1013	14	25,653,625 - 25,653,628	GRCz12tu	DIRECT	He et al., 2025
sa64	14	25,652,577	GRCz12tu	DIRECT	Sealy et al., 2025
	14	21,334,843	GRCz11	DIRECT	Busch-Nentwich et al., 2013
	14	21,037,598	GRCz10	DIRECT	Busch-Nentwich et al., 2013
	14	22,336,110	Zv9	DIRECT	Busch-Nentwich et al., 2013
sa66	14	25,652,577	GRCz12tu	DIRECT	Sealy et al., 2025
	14	21,334,843	GRCz11	DIRECT	Busch-Nentwich et al., 2013
	14	21,037,598	GRCz10	DIRECT	Busch-Nentwich et al., 2013
	14	22,336,110	Zv9	DIRECT	Busch-Nentwich et al., 2013
sa469	14	25,652,158	GRCz12tu	DIRECT	Sealy et al., 2025
	14	21,334,424	GRCz11	DIRECT	Busch-Nentwich et al., 2013
	14	21,037,179	GRCz10	DIRECT	Busch-Nentwich et al., 2013
	14	22,335,691	Zv9	DIRECT	Busch-Nentwich et al., 2013
sa42385	14	25,652,275	GRCz12tu	DIRECT	Sealy et al., 2025
	14	21,334,541	GRCz11	DIRECT	Busch-Nentwich et al., 2013
	14	21,037,296	GRCz10	DIRECT	Busch-Nentwich et al., 2013
	14	22,335,808	Zv9	DIRECT	Busch-Nentwich et al., 2013
a264	14		GRCz11	OTHER_MAPPING	ZFIN Curated Data
ihb423	14		GRCz11	OTHER_MAPPING	ZFIN Curated Data
ihb424	14		GRCz11	OTHER_MAPPING	ZFIN Curated Data
stl667	14		GRCz11	OTHER_MAPPING	ZFIN Curated Data

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
14	80.2 cM	egr1	Mother of Pearl (MOP)	Postlethwait, John H.	Data
14	2553.0 cR	egr1	Goodfellow T51 (T51)	Geisler, Robert	Data
14	66.3 cM	egr1	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Markers Encoded by egr1
fj64b05 Chr: 14 Details

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	820	DdeI	36.0
Forward Primer	GGGAGCAGTTTGATCACCTT
Reverse Primer	GTGAAACGGCCTGTGTAAGA

Genomic Feature ihb1012 is an allele of egr1