| ZFIN ID: ZDB-GENE-980526-90 |
| Gene Name: | achaete-scute family bHLH transcription factor 1a |
|---|---|
| Symbol: | ascl1a |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing ascl1a | |
|---|---|
| CH211-260P3 | Chr: 4 Details |
| DKEY-264K15 | Chr: 4 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| t25215 | 18 | GRCz11 | GENERAL_LOAD | ||
| ascl1a_unspecified | 4 | GRCz11 | OTHER_MAPPING | ||
| 4 | GRCz11 | OTHER_MAPPING | |||
| 4 | GRCz11 | OTHER_MAPPING | |||
| t25215 | 4 | GRCz11 | OTHER_MAPPING | ||
| 4 | GRCz11 | OTHER_MAPPING | |||
| 4 | GRCz11 | OTHER_MAPPING | |||
| 4 | GRCz11 | OTHER_MAPPING | |||
| 4 | GRCz11 | OTHER_MAPPING | |||
| zko2728A | 4 | GRCz11 | OTHER_MAPPING | ||
| 4 | GRCz11 | OTHER_MAPPING | |||
| 4 | GRCz11 | OTHER_MAPPING |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 4 | 109.6 cM | zasha | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 4 | 211.74 cR | zash-a | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 4 | 43.07 cM | asha | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Genomic Feature t25215 is an allele of ascl1a | ||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
||||||||||||||||||||
| Genomic Feature t25215 is an allele of ascl1a | |||
|---|---|---|---|
|
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 978 | 36.0 | |
| Forward Primer | CAACTTCTGGACGAGCATGA | ||
| Reverse Primer | TTCTGAGGGAGGCAAAACC |
| Genomic Feature zko2728A is an allele of ascl1a |