| ZFIN ID: ZDB-GENE-980526-558 |
| Gene Name: | WT1 transcription factor a |
|---|---|
| Symbol: | wt1a |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing wt1a | |
|---|---|
| DKEY-114A13 | Chr: 25 Details |
| CH73-152I22 | Chr: 25 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| sa17769 | 25 | 16,118,805 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 25 | 15,178,814 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 25 | 15,082,414 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 25 | 15,535,870 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| zf3845 | 25 | 15,213,957 - 15,213,961 | GRCz11 | DIRECT | Hopfenmüller et al., 2022 | |
| bns428 | 25 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 25 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 25 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| sa17769 | 25 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 25 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 25 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| zf3845 | 25 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 25 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 25 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 25 | 80.3 cM | wt1 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 25 | 207.86 cR | WT1 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 25 | 35.0 cM | wt1 | Heat Shock (HS) | Woods, Ian G. | Data |
| 25 | 37.63 cM | wt1 | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 726 | 36.0 | |
| Forward Primer | GCCTAGCCTGCTGTGTTATCCTT | ||
| Reverse Primer | CTGGTGTCGTTTTAGCTGGTCTGA |
| Genomic Feature bns428 is an allele of wt1a |