| ZFIN ID: ZDB-GENE-980526-212 |
| Gene Name: | distal-less homeobox 2a |
|---|---|
| Symbol: | dlx2a |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||
|
| Mapped Clones containing dlx2a | |
|---|---|
| CH211-245G15 | Chr: 9 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| sa11175 | 9 | 3,415,203 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 9 | 3,400,387 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 3,428,858 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 9 | 3,396,837 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| ot501 | 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | ||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 9 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | |||
| sa11175 | 9 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 9 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 9 | 7.5 cM | dlx2 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 9 | 163.03 cR | dlx2 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 9 | 0.0 cM | dlx2 | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 713 | Tsp509I | 36.0 |
| Forward Primer | AGCCACCACTTCATCACAAT | ||
| Reverse Primer | AGATGTTCATTCGGCTTTCA |
| Genomic Feature ot501 is an allele of dlx2a |