| ZFIN ID: ZDB-GENE-980526-438 |
| Gene Name: | neuropeptide Y |
|---|---|
| Symbol: | npy |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing npy | |
|---|---|
| DKEY-22M8 | Chr: 19 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| ct811 | 19 | 22,513,004 - 22,513,020 | GRCz12tu | DIRECT | Chen et al., 2013 | |
| kgs1 | 19 | 20,113,630 - 20,113,636 | GRCz11 | DIRECT | Shiozaki et al., 2020 | |
| kgs2 | 19 | 20,113,628 - 20,113,638 | GRCz11 | DIRECT | Shiozaki et al., 2020 | |
| ct811 | 19 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| kgs1 | 19 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| kgs2 | 19 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| nw17 | 19 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 19 | 70.6 cM | npy | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 19 | 66.6 cM | npy | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 565 | NlaIII | 36.0 |
| Forward Primer | CAGGGTGTGATTTTGTACTT | ||
| Reverse Primer | CACCCAAAAAGTAAGATTCA |
| Genomic Feature kgs2 is an allele of npy |