| ZFIN ID: ZDB-GENE-980526-438 | 
| Gene Name: | neuropeptide Y | 
|---|---|
| Symbol: | npy | 
PHYSICAL MAP AND BROWSER
                    
                    
                
            
        
    
    
        
        
            
    
    
    |  | ||||||||||||||||||||||||||||
| 
 | 
| Mapped Clones containing npy | |
|---|---|
| DKEY-22M8 | Chr: 19 Details | 
PHYSICAL MAPPING 
                    
                    
                
            
        
    
    
        
        
    | Feature | Chr | Position | Assembly | Source | DetailedSource | Citations | 
|---|---|---|---|---|---|---|
| ct811 | 19 | 20,113,586 - 20,113,603 | GRCz11 | DIRECT | Chen et al., 2013 | |
| kgs1 | 19 | 20,113,630 - 20,113,636 | GRCz11 | DIRECT | Shiozaki et al., 2020 | |
| kgs2 | 19 | 20,113,628 - 20,113,638 | GRCz11 | DIRECT | Shiozaki et al., 2020 | |
| ct811 | 19 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| kgs1 | 19 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| kgs2 | 19 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| nw17 | 19 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 19 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | 
| Chr | Location | Mapped As | Panel | Mapped By | Scoring | 
|---|---|---|---|---|---|
| 19 | 70.6 cM | npy | Mother of Pearl (MOP) | Postlethwait, John H. | Data | 
| 19 | 66.6 cM | npy | Heat Shock (HS) | Woods, Ian G. | Data | 
| Note: Physical map location as
            displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. | |||||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] | 
|---|---|---|---|
| SJD | 565 | NlaIII | 36.0 | 
| Forward Primer | CAGGGTGTGATTTTGTACTT | ||
| Reverse Primer | CACCCAAAAAGTAAGATTCA | 
| Genomic Feature kgs1 is an allele of npy | 
