ZFIN ID: ZDB-GENE-980526-171

ZFIN ID: ZDB-GENE-980526-171

Mapping Details

Gene Name:	T-box transcription factor 16, like
Symbol:	tbx16l

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN	5	43,089,816 - 43,111,541	GRCz12tu
NCBI Map Viewer	5	43,089,816 - 43,111,541	GRCz12tu
Ensembl	5	42,280,372 - 42,297,333	GRCz11
NCBI Map Viewer	5	42,280,576 - 42,302,297	GRCz11
UCSC	5	-	GRCz11
Vega	5	41,680,219 - 41,697,180	GRCv10

Mapped Clones containing tbx16l
CH211-207C6	Chr: 5 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Source	DetailedSource	Citations
sa31470	5	43,091,655	GRCz12tu	DIRECT		Sealy et al., 2025
	5	42,282,415	GRCz11	DIRECT		Busch-Nentwich et al., 2013
	5	41,682,262	GRCz10	DIRECT		Busch-Nentwich et al., 2013
	5	43,900,997	Zv9	DIRECT		Busch-Nentwich et al., 2013
z34	5	42,282,323 - 42,282,330	GRCz11	DIRECT		Morrow et al., 2017
z35	5	42,282,325 - 42,282,331	GRCz11	DIRECT		Morrow et al., 2017
sa31470	7		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	7		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	5		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
z34	5		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	7		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	7		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
z35	5		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGeneGBrowse
	5		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers
	7		GRCz11	OTHER_MAPPING	Feature location obtained from related gene that has mapped_marker info
	7		GRCz11	OTHER_MAPPING	featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
7	113.0 cM	tbx6	Mother of Pearl (MOP)	Postlethwait, John H.	Data
5	212.2 cR	tbx6	Loeb/NIH/5000/4000 (LN54)	Johnson, Stephen L.	Data
5	2958.0 cR	tbx6	Goodfellow T51 (T51)	Geisler, Robert	Data
5	86.5 cM	tbx6	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Primer Sets:
Strain	Bandsize	Annealing Temperature [C]
SJD	318	36.0
Forward Primer	AGGGTGAAGTGTTTTGGGGCATAA
Reverse Primer	GCGCTCTGGCACACCTCTTCTAAC

Genomic Feature z34 is an allele of tbx16l