header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-GENE-980528-2060

Mapping Details

Gene Name: goosecoid
Symbol: gsc
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 17 19,343,015 - 19,345,521
Ensembl 17 19,343,015 - 19,345,521
Vega 17 19,323,179 - 19,325,685
NCBI Map Viewer 17 19,343,015 - 19,345,495
UCSC 17 -
Mapped Clones containing gsc
DKEY-49F1 Chr: 17 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa32143 17 19,344,555 GRCz11 Busch-Nentwich et al., 2013
17 19,324,719 GRCz10 Busch-Nentwich et al., 2013
17 19,174,708 Zv9 Busch-Nentwich et al., 2013
x59 17 19,345,330 - 19,345,338 GRCz11 Kantarci et al., 2016

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
17 40.9 cM gsc Boston MGH Cross (MGH) Fishman, Mark C. Data
17 106.0 cM gsc_ABxDAR_ Mother of Pearl (MOP) Postlethwait, John H. Data
17 150.85 cR gsc Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
17 2036.0 cR gsc Goodfellow T51 (T51) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
IND NA
Forward Primer AGACAGAAAAGGTCGTCGTCA
Reverse Primer ACAGCCCATTCCAGAACATC
AB 401,NA
Forward Primer AGACAGAAAAGGTCGTCGTCA
Reverse Primer ACAGCCCATTCCAGAACATC
Genomic Feature x59 is an allele of gsc