ZFIN ID: ZDB-GENE-980526-487 |
Gene Name: | complement factor B |
---|---|
Symbol: | cfb |
PHYSICAL MAP AND BROWSER
|
Mapped Clones containing cfb | |
---|---|
DKEY-197A18 | Chr: 21 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
sa1866 | 21 | 27,426,555 | GRCz11 | Busch-Nentwich et al., 2013 |
21 | 27,389,860 | GRCz10 | Busch-Nentwich et al., 2013 | |
21 | 26,820,949 | Zv9 | Busch-Nentwich et al., 2013 | |
sa14271 | 21 | 27,418,124 | GRCz11 | Busch-Nentwich et al., 2013 |
21 | 27,381,429 | GRCz10 | Busch-Nentwich et al., 2013 | |
21 | 26,812,518 | Zv9 | Busch-Nentwich et al., 2013 | |
sa23958 | 21 | 27,416,691 | GRCz11 | Busch-Nentwich et al., 2013 |
21 | 27,379,996 | GRCz10 | Busch-Nentwich et al., 2013 | |
21 | 26,811,085 | Zv9 | Busch-Nentwich et al., 2013 | |
sa29609 | 21 | 27,426,307 | GRCz11 | Busch-Nentwich et al., 2013 |
21 | 27,389,612 | GRCz10 | Busch-Nentwich et al., 2013 | |
21 | 26,820,701 | Zv9 | Busch-Nentwich et al., 2013 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
21 | 82.5 cM | bf | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
21 | 190.79 cR | bf | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
21 | 4092.0 cR | bf | Goodfellow T51 (T51) | Geisler, Robert | Data |
21 | 81.1 cM | bf | Heat Shock (HS) | Woods, Ian G. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
gng3 | GENE | 21 | 10.76 cR | Kelly et al., 2001 | Kelly et al. (2001., Int. J. Devl. Neuroscience 19:455-467) report mapping gng3 to LG21 aproximatly 10.76 cR from the gene bf on the LN45 mapping panel. |
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 259 | 36.0 | |
Forward Primer | TATGGCCGACTGATTCAGATTGGT | ||
Reverse Primer | TCCATGCTATTTAGCCAGTCTTTT |
Genomic Feature sa29609 is an allele of cfb |