| ZFIN ID: ZDB-GENE-980526-442 |
| Gene Name: | growth differentiation factor 6b |
|---|---|
| Symbol: | gdf6b |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing gdf6b | |
|---|---|
| DKEY-158E13 | Chr: 19 Details |
| CH211-244A23 | Chr: 19 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| sa23521 | 19 | 25,410,424 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 19 | 23,001,848 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 19 | 23,417,525 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 19 | 23,488,110 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa36836 | 19 | 25,410,404 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 19 | 23,001,828 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 19 | 23,417,505 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 19 | 23,488,090 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa43280 | 19 | 25,410,394 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 19 | 23,001,818 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 19 | 23,417,495 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 19 | 23,488,080 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| zf3339 | 19 | 22,999,561 - 22,999,568 | GRCz11 | DIRECT | Gramann et al., 2019 |
| 19 | GRCz11 | OTHER_MAPPING | |||
| 19 | GRCz11 | OTHER_MAPPING | |||
| 19 | GRCz11 | OTHER_MAPPING | |||
| 19 | GRCz11 | OTHER_MAPPING |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 19 | 94.3 cM | dynamo | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 19 | 66.6 cM | gdf6b | Heat Shock (HS) | Woods, Ian G. | Data |
| 19 | 40.42 cM | dynamo | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| mc5ra | GENE | 19 | 0.0 cM | Ringholm et al., 2002 | Ringholm et al. (2002, J Neurochem 82(1):6-18) report mapping mc5ra to LG 19, 12.3 cM from hoxa11a, indistinguishably close to gdf6b, using the Heat Shock mapping panel. |
| hoxa11a | GENE | 19 | Ringholm et al., 2002 | Ringholm et al. (2002, J Neurochem 82(1):6-18) report mapping mc5ra to LG 19, 12.3 cM from hoxa11a, indistinguishably close to gdf6b, using the Heat Shock mapping panel. |
| Markers Encoded by gdf6b | |||
|---|---|---|---|
| fc13c07 Chr: 19 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 204 | 36.0 | |
| Forward Primer | TGTTTTTATCCAAGCAGTTCTCAC | ||
| Reverse Primer | CATTCTTGCCGTATTTTGCTCTCC |
| Genomic Feature sa23521 is an allele of gdf6b |