ZFIN ID: ZDB-GENE-980528-2059

Mapping Details

Gene Name: bone morphogenetic protein 4
Symbol: bmp4
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 17 56,628,261 - 56,649,377 GRCz12tu
NCBI Map Viewer 17 56,628,261 - 56,649,377 GRCz12tu
Ensembl 17 50,564,070 - 50,586,135 GRCz11
NCBI Map Viewer 17 50,564,103 - 50,586,135 GRCz11
UCSC 17 - GRCz11
Vega 17 50,485,001 - 50,507,066 GRCv10
Mapped Clones containing bmp4
CH211-287A24 Chr: 17 Details
CH73-374D11 Chr: 17 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
b1150 17 50,584,570 GRCz11 DIRECT Lenhart et al., 2011
ouc1003 17 50,574,389 GRCz11 DIRECT Chen et al., 2023
sa36537 17 56,647,712 GRCz12tu DIRECT Sealy et al., 2025
17 50,584,570 GRCz11 DIRECT Busch-Nentwich et al., 2013
17 50,505,501 GRCz10 DIRECT Busch-Nentwich et al., 2013
17 51,114,684 Zv9 DIRECT Busch-Nentwich et al., 2013
st72 17 50,584,131 GRCz11 DIRECT ZFIN Curated Data
umo32 17 50,574,163 - 50,574,167 GRCz11 DIRECT Zebrafish Nomenclature Committee
la010179Tg 17 51,095,488 - 51,095,498 Zv9 ZFIN_Zv9 BurgessLin
la013167Tg 17 51,094,290 - 51,094,300 Zv9 ZFIN_Zv9 BurgessLin
b1149 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
b1150 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
b1172 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
la010179Tg 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
la013167Tg 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
ouc1003 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
sa36537 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
st37 17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING linkagesDirectMem2
17 GRCz11 OTHER_MAPPING linkagesDirectMem1
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
st72 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
umo32 17 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
17 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
17 67.7 cM bmp4 Boston MGH Cross (MGH) Fishman, Mark C. Data
17 197.2 cM bmp4 Mother of Pearl (MOP) Postlethwait, John H. Data
17 413.93 cR bmp4 Loeb/NIH/5000/4000 (LN54) Johnson, Stephen L. Data
17 4952.0 cR bmp4 Goodfellow T51 (T51) Geisler, Robert Data
17 113.5 cM bmp4 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z9692 SSLP 17 Stickney et al., 2007 mutation mapped by Stickney et al. (2007)
z11340 SSLP 17 Stickney et al., 2007 mutation mapped by Stickney et al. (2007)
st37 Feature 17 0.0 cM Stickney et al., 2007 mutation mapped by Stickney et al. (2007)

OTHER MAPPING INFORMATION
Genomic Feature st37 is an allele of bmp4
Marker Type Chr Distance Publication / Person Comments
bmp4 GENE 17 0.0 cM Stickney et al., 2007 mutation mapped by Stickney et al. (2007)
z9692 SSLP 17 Stickney et al., 2007 mutation mapped by Stickney et al. (2007)
z11340 SSLP 17 Stickney et al., 2007 mutation mapped by Stickney et al. (2007)
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
AB NA
Forward Primer CTGTGAGGAGCTTCCATCACGAA
Reverse Primer GGAATCGGCAGAGGCTGTCTCC
IND NA
Forward Primer CTGTGAGGAGCTTCCATCACGAA
Reverse Primer GGAATCGGCAGAGGCTGTCTCC
SJD 307 36.0
Forward Primer TAGGCTGGAACGACTGGATT
Reverse Primer TGTCCACGTGTGGATGTTTT
Genomic Feature sa36537 is an allele of bmp4