ZFIN ID: ZDB-GENE-980526-487

Mapping Details

Gene Name: complement factor B
Symbol: cfb
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 21 30,465,934 - 30,481,310 GRCz12tu
NCBI Map Viewer 21 30,465,934 - 30,481,310 GRCz12tu
Ensembl 21 27,416,284 - 27,431,397 GRCz11
NCBI Map Viewer 21 27,416,291 - 27,431,397 GRCz11
UCSC 21 - GRCz11
Vega 21 27,379,589 - 27,394,702 GRCv10
Mapped Clones containing cfb
DKEY-197A18 Chr: 21 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
sa1866 21 30,476,250 GRCz12tu DIRECT Sealy et al., 2025
21 27,426,555 GRCz11 DIRECT Busch-Nentwich et al., 2013
21 27,389,860 GRCz10 DIRECT Busch-Nentwich et al., 2013
21 26,820,949 Zv9 DIRECT Busch-Nentwich et al., 2013
sa14271 21 30,467,756 GRCz12tu DIRECT Sealy et al., 2025
21 27,418,124 GRCz11 DIRECT Busch-Nentwich et al., 2013
21 27,381,429 GRCz10 DIRECT Busch-Nentwich et al., 2013
21 26,812,518 Zv9 DIRECT Busch-Nentwich et al., 2013
sa23958 21 30,466,334 GRCz12tu DIRECT Sealy et al., 2025
21 27,416,691 GRCz11 DIRECT Busch-Nentwich et al., 2013
21 27,379,996 GRCz10 DIRECT Busch-Nentwich et al., 2013
21 26,811,085 Zv9 DIRECT Busch-Nentwich et al., 2013
sa29609 21 30,476,000 GRCz12tu DIRECT Sealy et al., 2025
21 27,426,307 GRCz11 DIRECT Busch-Nentwich et al., 2013
21 27,389,612 GRCz10 DIRECT Busch-Nentwich et al., 2013
21 26,820,701 Zv9 DIRECT Busch-Nentwich et al., 2013
sa1866 21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa14271 21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
sa23958 21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
sa29609 21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
21 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneLinkage
21 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
21 82.5 cM bf Mother of Pearl (MOP) Postlethwait, John H. Data
21 190.79 cR bf Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
21 4092.0 cR bf Goodfellow T51 (T51) Geisler, Robert Data
21 81.1 cM bf Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
gng3 GENE 21 10.76 cR Kelly et al., 2001 Kelly et al. (2001., Int. J. Devl. Neuroscience 19:455-467) report mapping gng3 to LG21 aproximatly 10.76 cR from the gene bf on the LN45 mapping panel.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 259 36.0
Forward Primer TATGGCCGACTGATTCAGATTGGT
Reverse Primer TCCATGCTATTTAGCCAGTCTTTT
Genomic Feature sa14271 is an allele of cfb