| ZFIN ID: ZDB-GENE-980526-362 |
| Gene Name: | catenin (cadherin-associated protein), beta 1 |
|---|---|
| Symbol: | ctnnb1 |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing ctnnb1 | |
|---|---|
| CH73-49B13 | Chr: 16 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | DetailedSource | Citations |
|---|---|---|---|---|---|---|
| sa11589 | 16 | 6,418,216 | GRCz12tu | DIRECT | Sealy et al., 2025 | |
| 16 | 6,192,788 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 16 | 6,291,620 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | ||
| 16 | 7,445,782 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | ||
| la019872Tg | 16 | 7,458,556 - 7,458,566 | Zv9 | ZFIN_Zv9 | BurgessLin | |
| hg101 | 16 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 16 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| 16 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| la019872Tg | 16 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 16 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 16 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers | |||
| sa11589 | 16 | GRCz11 | OTHER_MAPPING | Feature location obtained from related gene that has mapped_marker info | ||
| 16 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGeneGBrowse | |||
| 16 | GRCz11 | OTHER_MAPPING | featureLocationPullThruFromGenePaneledMarkers |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 16 | 42.2 cM | ctnnb | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 16 | 75.35 cR | IBD2058 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 16 | 17.6 cM | ctnnb | Heat Shock (HS) | Woods, Ian G. | Data |
| 16 | 14.58 cM | ctnnb | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by ctnnb1 | |||
|---|---|---|---|
| fb73e10 Chr: 16 Details | |||
| fi81c06 Chr: 16 Details | |||
| fk25h01 Chr: 16 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 829 | 36.0 | |
| Forward Primer | CAATCAGCTGGCCTGGTTT | ||
| Reverse Primer | GCCAAGTCTCCAACCAACAA |
| Genomic Feature la019872Tg is an allele of ctnnb1 |