ZFIN ID: ZDB-GENE-980526-330

Mapping Details

Gene Name: caudal type homeobox 4
Symbol: cdx4
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN 14 37,508,051 - 37,511,542 GRCz12tu
NCBI Map Viewer 14 37,508,051 - 37,511,542 GRCz12tu
Ensembl 14 32,961,718 - 32,965,169 GRCz11
NCBI Map Viewer 14 32,961,703 - 32,965,169 GRCz11
UCSC 14 - GRCz11
Vega 14 32,621,404 - 32,624,855 GRCv10
Mapped Clones containing cdx4
CH211-231B5 Chr: 14 Details
CH211-276G21 Chr: 14 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Source DetailedSource Citations
ch107 14 32,965,088 GRCz11 DIRECT Rocha et al., 2021
hi2092Tg 14 32,964,321 - 32,964,322 GRCz11 DIRECT ZFIN Curated Data
hi2188aTg 14 32,964,452 - 32,964,453 GRCz11 DIRECT ZFIN Curated Data
ch107 5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
hi2092Tg 14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
hi2188aTg 14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
hi2617Tg 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
tl240a 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING directMappedMarker
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
14 GRCz11 OTHER_MAPPING paneledMarkersDirect
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
tv205c 14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING featureLocationPullThruFromGeneGBrowse
5 GRCz11 OTHER_MAPPING featureLocationPullThruFromGenePaneledMarkers
14 GRCz11 OTHER_MAPPING linkagesDirectMem2
14 GRCz11 OTHER_MAPPING Feature location obtained from related gene that has mapped_marker info
14 GRCz11 OTHER_MAPPING linkagesDirectMem1

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
14 117.4 cM cad1 Mother of Pearl (MOP) Postlethwait, John H. Data
14 84.5 cM cad1 Heat Shock (HS) Woods, Ian G. Data
14 71.88 cM cad1 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Chr 14 ZFIN Curated Data ZFIN historical data
Markers Encoded by cdx4
zk14a10.t7 Chr: 5 Details
Genomic Feature tl240a is an allele of cdx4
Chr Location Mapped As Panel Mapped By Scoring
14 57.2 cM tl240a Boston MGH Cross (MGH) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
Genomic Feature tv205c is an allele of cdx4
Marker Type Chr Distance Publication / Person Comments
kdrl GENE 14 2.0 cR Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
fb79h04 EST 14 26.0 cR Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
fa10f09 EST 14 Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
fc54b04 EST 14 Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
fb75e04 EST 14 Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
fc41g06 EST 14 Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
fd02c12 EST 14 Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
fj63c09 EST 14 Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
chic1 GENE 14 Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
z11437 SSLP 14 Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
z13401 SSLP 14 Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
z20545 SSLP 14 Davidson et al., 2003 Davidson, A.J. et al (2003, Nature 425(6955):300-306)mapped kggtv205 to LG14 using the Goodfellow radiaion hybrid panel.
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 271 36.0
Forward Primer AGGCAAGCATGTATCACCAAGGAG
Reverse Primer TAATCGGGCGAGCAATAGGAAACT
Genomic Feature hi2617Tg is an allele of cdx4