Community Action Needed: Please respond to the NIH RFI
Genomic Feature

tt250

ID
ZDB-ALT-980413-523
Name
tt250
Synonyms
  • AT50A (1)
  • tt350
Affected Genomic Region
Construct
None
Type
Allele with one point mutation
Protocol
ENU 
Lab of Origin
Nüsslein-Volhard Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
The chordino allele dintt250 has been reported to have a 104 bp deletion on the cDNA level (Schulte-Merker, et al., 1997). On the genomic level, these 104 bp are encoded by a distinct exon. dintt250 mutant genomic DNA shows a G -> A exchange in the splice donor site of the intron downstream of the 104 bp exon (TGAGCCGgtgattgt -> TGAGCCGatgattgt, capital letters exon, small letters intron), leading to false splicing and the reported deletion of the exon. Taking advantage of this point mutation, genotyping of the chordino mutation din(tt250) was performed via allele-specific PCR in two separate PCR reactions, using either a wild-type or mutant-specific primer in antisense orientation. PCR conditions and primers used were: 94°C (3 min), 13 cycles of 94°C (30 sec), 66°C (45 sec), 72°C (1 min), 20 cycles of 94°C (30 sec), 46°C (45 sec), 72°C (1 min), followed by 72°C (10 min). Sense primer for both reactions CGATTCAAGACACAAATGCGGG, wild-type antisense primer CTGTGCACAACTCAC, mutant antisense primer ACTGTGCACAACTCAT.
The chordino allele dintt250 has been reported to have a 104 bp deletion on the cDNA level (Schulte-Merker, et al., 1997). On the genomic level, these 104 bp are encoded by a distinct exon. dintt250 mutant genomic DNA shows a G -> A exchange in the splice donor site of the intron downstream of the 104 bp exon (TGAGCCGgtgattgt -> TGAGCCGatgattgt, capital letters exon, small letters intron), leading to false splicing and the reported deletion of the exon. Taking advantage of this point mutation, genotyping of the chordino mutation din(tt250) was performed via allele-specific PCR in two separate PCR reactions, using either a wild-type or mutant-specific primer in antisense orientation. PCR conditions and primers used were: 94°C (3 min), 13 cycles of 94°C (30 sec), 66°C (45 sec), 72°C (1 min), 20 cycles of 94°C (30 sec), 46°C (45 sec), 72°C (1 min), followed by 72°C (10 min). Sense primer for both reactions CGATTCAAGACACAAATGCGGG, wild-type antisense primer CTGTGCACAACTCAC, mutant antisense primer ACTGTGCACAACTCAT.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr: 15 Details
Nucleotide change
Variant Notes
The chordino allele dintt250 has been reported to  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Splice Site, Exon Loss (1)
Protein Consequence
None
Sequences
Flanking Sequence

Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
tt250.pdf
Citations