Genomic Feature

m134

ID
ZDB-ALT-980203-469
Name
m134
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 10: 1956387 (GRCz11) (1) Details
Nucleotide change
G/T
Variant Notes
C-608 is mutated to A, which changes Ser-168 to a stop codon (ZDB-PUB-980209-1).
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>A at position 608 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Ser>Stop at position 168 (1)
Sequences
Flanking Sequence
AAGGACAGAATTCATTTGGCTCGGCGGCGCACTGACACACACACACAATATATTTTCAATATAAATCCTATATACATGTTCCTTCACTAAACAGCTCTTAACACAGCTAGTTAGACTTCCACTGGAAGCAAAAACACATTTCAGTGCCACCAATAAATGCTGCCCGAACCTGTCAGACAGAAAAAAATCTAAAATAAAACCGCTTTCTGTTTGTTAAAGGGATAGTTCACACGAAAATGAACACATTTACTCATCCTTCAACGGTTTAAAACCTATTTGAGAGCTGCTTCCTTCTCTTGGGCACAAAAGAGAAATGCTGGTTCACTTCCATAGTAATGTTTCCCCTACTATGGAAGTCAAGTGCCAGCATTTTTCAAAGTATCTTCTTCTGCGTTCAACAGGGGAGATCATTTTCTTTGTTTGGGTGAACTATCCCATTAGGAAAACTCATTTACAGCAGGCGGTGTAAAATAAAAGGGGCGAACATGACAATTGTAGAC
G/T ACAGTGTTCTGAGGGAGCCCGACCGGTGCCACCGAACTTCCTGAGAGTCATCTGAAAGAAAATATAAACAAATAAGTTAAATATAAAGACATAGACAAGTGTAATCTGAAGAAACCGCTTCTCAAACAAGAAACAGACAGTCTGAATAATCATCTGAGGTCCGTCAGTTTGGATCAACGCTAGTCAGTGATTCACAGCACTATTAGCGCAGCGTTAGAGGTGAGAAACTCTGCTGGCTTTCTATTGTTGTGCATTTCTAAGTAAACTGGTTACAGCAGACTGATGGGTATTAAAGGAACACTCTACTTTTTTGGAAACAGGCTAGTTTTACAGCTCTCCTAAAGTTAAACAGTCAAGTTTTACCATTGTTTCATTGATTTAGCTGATCTTCAGGTCTAGCGGGAGCACTCTTAGCTTAGCATAAATCATTGAATCGGATTAGACCATTAGCATCTCGCTCAAATTTCAAAAAATGAGTTTTGATAATCGTATACAGTGGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations