Genomic Feature

ty119

ID
ZDB-ALT-980203-1788
Name
ty119
Synonyms
  • Y119A (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 9: 37294015 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
"In yot ty119 C3148 is mutated to U,
changing Arg-929 to a stop codon."  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>T at position 3148 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Arg>Stop at position 929 (1)
Sequences
Flanking Sequence
CAATGCTTAATCAGCTACATGAGCGCAGAGATAGCTCCACCAGCACAATGAGCTCAGCATATATAAGCCGTCGGTCCTCTGGCATTTCACCTTGCTACTCCAGTCGTCGCTCAAGTGAGGCTTCGCAATTTGGAGTCCGCAACAACAATGTCAGCTCAGCAGACTCCTATGACCCGATCTCCACAGATCTGTCACGTCGTTCCAGTGAAGCAAGCCAATGTGGTGGTACAGGTGGGCTCCCAAGTTTACTAAATCTCACACCAGCTCAACACTACAGTCTTAAGGCGAAATATGCTGCAGCCACTGGGGGTGCACCACCAACACCTCTGCCCAACATGGATCGCATGAGCCTTAAAACTAGAATGGCCATGTACAATGACTCGCAGGACAGTTCAGCACATTTGCACCATGCCCAAGGTGTAGTCAACTCAAGACGCTGCAGCGACACTGGGTACGGTGCCCCTGGCATAATGCCTCATGAAGTTCCGGCCAATCTTCCA
C/T GACGAGCAAGCGATCCTGTTCGTCGTACAACTCTTGACCCACTCTCCTTGCCAAGAGTTCAGCGGTTCAACAGCATCAGCAACATGAACCTATCACGTCTGCCTGCATATGATCGACGTGCTTTCAACATGCAGAACAACACTTGGTCTGATGGAAGCTTGCACCGTCATCCCTTCAGCCAAAGGCCACCTAGCATATCAGAGAACATTTTAATGGAAAATATGGCCACTGATGGAGGAGATCAACAAGGGGATGATTTGGTGCTTCCCGATGACATGGTACAGTACCTCAGGTCCCAGAATGGTAACTCAAATCACGATTCTGGGATTTCTGTCAATGGCGGTCATGCTCTAGAGTTCCATGGTAATATGACCTCCCAACAACAACAGTTCTATGGGCAACGCAGAATGGGCATGGCAAGCATCAATGGAAGTCACGTAGAGCCTGTTCCAGAACAAATAGCTGATCCGCAGGGCATGAACAAAAACAACATGCCTGTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations