Genomic Feature

tz216

ID
ZDB-ALT-980203-1671
Name
tz216
Synonyms
  • AZ016A (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 5: 36515987 (GRCz11) (1) Details
Nucleotide change
G/T
Variant Notes
The point mutation GGA (G155) to TGA (Stop) results in truncation of the  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>T (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Gly>Stop at position 155 (1)
Sequences
Flanking Sequence
CATAGTATTTTTCTACTATGAATTTCAATAGTTAACAACTGATTTCCAACATTTTTCTAATTATCTTCTTTTCTGTTTAATGGAAAAGCAAAATGCATTTTAGTATAATTTTAGTATTTGGGTGATTCCATTAGGACAGATGTGAACAAACAAATAAAAAGGAAAAATACCAGCAGAGTCCAACAGCATCAGGTTTTATTGTTATCATTATAACAATTAAAAAGTACAAAACCATTAGAATGTTTGTGATGGTTTCCAATAGGTTTTTTTTAAGCATGGGAGTATCATCTGTTTGTGTTCAGCTTTTAGATGTATGATAGAAACTGATGATCTAACAGTGTGGTCTCTGTGCAGGGACCCGTGAGGCAGCGTTTGTGTTTTCTCTGGCTGCTGCGGTGGTCAGTCATGCCATAGCTCGTGCCTGTGCATCTGGAGACCTGCCCAGCTGTTCCTGTGCTGCAATGCCGTCAGAGCAGGCGGCTCCTGATTTCCGCTGGGGT
G/T GATGTGGAGATAACCTTCGCTACGGCCTACAGATGGGCTCCGCTTTCTCAGATGCACCAATAAGGAACCGGCGCTCGGGCCCACAGGCCTTTAGACTCATGCAGCTTCACAACAATGCTGTTGGCAGACAGGTAAAGCCTCAACCACATGCTGGATTTCCACAGAAGACTGGCATCATTCACTGTAGACATAGCAGGGTTCCATTCAATTCATTCAGGTTGTCTCAACACAAATCTATTAGGTGACTTAACAATCTGAGTAGATTGAACATAAAACAATCGTTGTCCCAAACATAAAACAACAAGTTGTCCCAAAAAATCTTAAGAGTTGTGTTGATTAAGCTCATTTTACATAAGTAGCATGAACAGGTCACAGTAAATTAATAATGAAAATAGTAATTATTTTTTTGAGTGTTTCGATCAGTATCATGAATCTGTGTGTTCGTGTTTGTAAAGGTGCTTATGGACTCTCTAGAGATGAAGTGCAAATGTCATGGCGTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations