Genomic Feature
tf219
- ID
- ZDB-ALT-980203-1458
- Name
- tf219
- Synonyms
-
- AF19A (1)
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one point mutation (1)
- Protocol
- adult males treated with ENU
- Lab of Origin
- Nüsslein-Volhard Lab
- Current Source
-
Zebrafish International Resource Center (ZIRC)
(
order this
)
European Zebrafish Resource Center (EZRC) ( order this ) - Other Pages
Notes
No data available
Variants
- Variant Type
- Point Mutation
- Variant Location
- Chr 12: 48204988 (GRCz11) (1) Details
- Nucleotide change
- G/A
- Variant Notes
- None
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- G>A (1)
- Transcript Consequence
- Missense (1)
- Protein Consequence
- Amino Acid Substitution: Met>Ile at position 1 (1)
- Flanking Sequence
-
CCTGTGTGAATTACCTTAACATTTTACATTGGTCAAAACAAATATAGTTGAGCTCTTAATCAAAAACATTCACATTAAACTATGATTTGAACTTAAAATATATTTGAAAAATAAAATAAAAAATTTTAAGAGACTATTTAATTGAATAAATACTGCTTGCAAGTTATTTTACTGTATAGCTAATTTATATAAGCAGTTTGAACAAACAAAGTGCAGCAAAGTATCCACGTTTAATGTAATATAATCACAGCAGTTCACGTAGCTACATTACCTTCAAAGGACGAGCGCGGTGACGTCACGCGCGGGCGCAAGGTGTTTTAATTGTTGCTCGTAAAAAATGCGCCTCATTACCACACGAATAGATGATGAGCTGTCACGGCATGTCAATTTCCTTTAATGTCCTCTGCTACTTGTTAAATATGCGGGGGTCCGACTCGAGGGAGGCCCTATATAAAGCGCCCGGGACTCCCGAGCTGTCATTCATTCTGACCGCGCATCAT
G/A CACGCGCTCGGAGTCGCGCGCCTGGCTTGCTACTGCCAGCTGCTGCTGCTCGGAGTGTTCGGAAAGCACACGCGTTATCGTCACAATAATTATAACAGCTTGAGGAATATGTCACACCGCATGCATCTGCCCACGTACATGATGCATCTCTATCGGCATTACAAGATGAACCAGACGCGCATACCCGCGGAGAGCCTCGAGCACGAGCACGCAGACACAATCAGGAGCATCATGTCTAAAAGTAAGGCTGTTTTTATTTTTTTGTAGGGTTTTAAATGTTTTACTTTAGCTGTGAGAGTGAGTGAAGTGTGTGTATAAAGCTCAATGGCGTTTTCAGCAGTGCGGTATTTATAAATAATCAATAAAAAATATAATATAAACCTTAAATACAAAGCAAAAACAGCTATAGAAAATATAAAGAAACCTTAAGTAGCCCATATTAAAAAATGTAAATAAATTAGACATATATTAGAGTGATTGACGGTACAATAATAGTAAAA - Additional Sequence
- None
Fish
| Fish | Genomic Feature Zygosity | Parental Zygosity | Affected Genomic Regions | Phenotype | Gene Expression |
|---|---|---|---|---|---|
| ndr2tf219/tf219 | Homozygous | ♀+/- ♂+/- | 6 figures  from 5 publications | 6 figures from 5 publications | |
| ndr2tf219/+ (AB) | Heterozygous | Unknown | |||
| ndr2tf219 | Unknown | Unknown | |||
| ndr2tf219/tf219; Df(Chr07)t4/t4 | Complex | 2 figures from Hammond et al., 2003 | |||
| gli1tm276b/tm276b; ndr2tf219/tf219 | Complex | ||||
| ndr2tf219/tf219; shhatbx392/tbx392 | Complex | ||||
| ndr2tf219/tf219; Df(Chr07)t4/t4 + MO1-ptch1 + MO1-ptch2 | Complex | Fig. 2 from Wolff et al., 2003 | |||
| ndr2tf219/tf219 + MO1-ptch1 + MO1-ptch2 | Complex | Fig. 2 from Wolff et al., 2003 |
1 - 8 of 8
Show
Supplemental Information
- Genotyping protocol
- None
- Swindell, E.C., Zilinski, C.A., Hashimoto, R., Shah, R., Lane, M.E., and Jamrich, M. (2008) Regulation and function of foxe3 during early zebrafish development. Genesis (New York, N.Y. : 2000). 46(3):177-183
- Bisgrove, B.W., Snarr, B.S., Emrazian, A., and Yost, H.J. (2005) Polaris and Polycystin-2 in dorsal forerunner cells and Kupffer's vesicle are required for specification of the zebrafish left-right axis. Developmental Biology. 287(2):274-288
- Essner, J.J., Amack, J.D., Nyholm, M.K., Harris, E.B., and Yost, H.J. (2005) Kupffer's vesicle is a ciliated organ of asymmetry in the zebrafish embryo that initiates left-right development of the brain, heart and gut. Development (Cambridge, England). 132(6):1247-1260
- Lehmann, C., and Naumann, W.W. (2005) Axon pathfinding and the floor plate factor Reissner's substance in wildtype, cyclops and one-eyed pinhead mutants of Danio rerio. Brain research. Developmental brain research. 154(1):1-14
- Zilinski, C.A., Shah, R., Lane, M.E., and Jamrich, M. (2005) Modulation of zebrafish pitx3 expression in the primordia of the pituitary, lens, olfactory epithelium and cranial ganglia by hedgehog and nodal signaling. Genesis (New York, N.Y. : 2000). 41(1):33-40
- Bischof, J., and Driever, W. (2004) Regulation of hhex expression in the yolk syncytial layer, the potential Nieuwkoop center homolog in zebrafish. Developmental Biology. 276(2):552-562
- Albert, S., Müller, F., Fischer, N., Biellmann, D., Neumann, C., Blader, P., and Strähle, U. (2003) Cyclops-independent floor plate differentiation in zebrafish embryos. Developmental Dynamics : an official publication of the American Association of Anatomists. 226(1):59-66
- Hammond, K.L., Loynes, H.E., Folarin, A.A., Smith, J., and Whitfield, T.T. (2003) Hedgehog signalling is required for correct anteroposterior patterning of the zebrafish otic vesicle. Development (Cambridge, England). 130(7):1403-1417
- Tian, J., Yam, C., Balasundaram, G., Wang, H., Gore, A., and Sampath, K. (2003) A temperature-sensitive mutation in the nodal-related gene cyclops reveals that the floor plate is induced during gastrulation in zebrafish. Development (Cambridge, England). 130(14):3331-3342
- Wolff, C., Roy, S., and Ingham, P.W. (2003) Multiple muscle cell identities induced by distinct levels and timing of hedgehog activity in the zebrafish embryo. Current biology : CB. 13(14):1169-1181
1 - 10 of 21
Show