Community Action Needed: Please respond to the NIH RFI
Genomic Feature

tz257

ID
ZDB-ALT-980203-1256
Name
tz257
Synonyms
  • AZ057A (1)
  • te57 (1)
  • tz57
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Nüsslein-Volhard Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
Contains an A-to-G point mutation in the start codon resulting in the initiation of translation 9 aa downstream of the typical start site (ZDB-PUB-980209-1).
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 10: 1961576 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
Contains an A-to-G point mutation in the start codon resulting in the  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>G in Start Codon (1)
Transcript Consequence
Start Loss (1)
Protein Consequence
None
Sequences
Flanking Sequence
ATATCTGAGGGAAAATTACTCGTTTATGCAACATCTACAATATCTATGTGTACGTATTGCGTTAATGACAATCTCACCTCCGGTCAGTCCAACGAACGGTAACGCTGCCTCGGCGTTGCGGTGTTGACGTTGCGGCGTTTGCGTGTTCATTTCGTTAAATTTATTCAAGAATTCAGCGTATTGCTTTGGCTTTCCAGAAACCCCAACTTTCACACATTCTGACCCCTCACATCCTGAGAGAAAAATACAAATACATATTAGAAAAAAAGACGGAAATACAGTCACGCACGGATGTAAACAAAAAAGATTCGACGCTTACCTGACTCGAGTGAAACAGCTTGACAAATAATCACAGCAAACATCAAGAACCTGGAGGTGAAAATAAGAAAATTAAGTATATTATGGATAAAATGAAAGGCCTGAGCAGATAAAAACAAACGAGCGAATCATCCAAAATATGACTCGTGAATCATTTGCTCACCCGAACAGTTGACTCGTCA
T/C TCCGCTGGCCAATAAACTCCAAAACAACTCGATTGAGGTAAGTTTTCGTATCCCAAAAACACCATTAGAACATCTCCATCTCACAGAACTTCTATCTGTGCCTGTGTTTGGGTCTGTTATTTATCTCGAGGGCCTCAGACTCCCCCATTCACACCTGTAAACCCTCCCATAGTCATGCATGCGCGCACACCCACTAATGCAAACGAGTCCCCATTCATATTCCGTCAGTCAAACCGGTTTGAAGCGAATCGACTCAGTTCAGTATCACAGAGAAGCGATTAGCGACTTTTGATGCTTCTAATGCGGGACTTTACTAAAGATGTTTATTTCTCATGTGAAAAACTTAGAATACAGATGAGCTTTCAGATGAAACACACGCTTGCGCTCATTTATTCATACAGCTGAGTAATGTATGACTCTATGACTTACTCATGACTGAGGAAGCTATATGTATTAATTATGTGACACTAATGAAAACGTGCTTATTATTTATTACTTAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations