Genomic Feature

zf3029

ID
ZDB-ALT-200106-2
Name
zf3029
Synonyms
  • Glo1em2HU (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Vascular Signaling Group
Current Source
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Small Deletion
Variant Location
Chr 13: 44804281 - 44804288 (GRCz11) (1) Details
Nucleotide change
CGTCCAGG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
None
Sequences
Flanking Sequence
TGAAGAGAGAATTATGAGTATGGCGGGAAGTTTCGCGAGTCTCCGGATGCACGCAAACGAGTGATGATCTCCCGGTAATCTCGCGTCTCCCTCCCGGTCCTCACCGGGCATCGTCGTGCACCCTTCTCACCCCTCCCCACCGCATCTCTCCTCAGACACGTCGCGCGCGCACCCTGTCAATCACCACTAAACCACCACCTCTCCTGACAGCTTAGCGGGACGCTGCAAAATAAACCCTGACACTCTGACCAATGTAAGGAGAGTTTACTCGCACGTGACTTGTTTTAGCTCTTTTGGTCCGATTAGAAACTTTGCAATGTGAAAGCGAACCGCTCCAAGAGCAAAGTGCAACAATGTAACAATTGTAATCTCTGTTTCGGAACAACTGAATCGATTCACAGGTGTGAAAGCACCCTTAGTATATCGCCCAACACTAGCACACACACACACACACACACACACACTTACTGAGTGAGCTCTATAGTGGCTCTACGGGAGAA
CGTCCAGG/- CCGTCCTCTCCTTCACATCTGCAGGGATCTCTTTCTTATCTTCGTAACCCAGAAAGTAGAGGGTGAAGCGCATCGAGGGGAAATCAAACTTCTGTAACAGCCTACAAATAAAACATCCACACATTAAGGCCACCTCAATGCTTCACTGATCTTCACTTTTAAGCAGGGGTACACAAAATGCATAAGTGCATGCACGGTTAAAGGGTTAGTTCGATTACTTTTGTGTGGCAAAAACACCACAACAGTTCAGGGTGCACGTTTACTATGGGCAATAGGTCAGCAGCACAGCACAAGCATTATATTGCTCATAATAAATGCGCACCATGTGGAAGACTAAAGTTTTTGGTGCGCAAAAGTGTTCTTGGAGCTTCGTATCATTACAGTTGAATCACATAAAATCTTTTGACAACGTTTTCGGTTCCTCTTCTGGACTCTTTTTGCAGTCTATGGAGGTTGAGAGAGCTTTGGGATTTTATCTAAAATAACTTAATTTGTGTTCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations