ZFIN ID: ZDB-ALT-190813-9
Genomic Feature: bns301
Synonyms: vegfaa5′UTRΔ10 (1)
Affected Genomic Regions: vegfaa (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-vegfaa
Lab Of Origin: Stainier Lab
Location: Chr 16: 4317386 - 4317395 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 10 bp deleted in Exon 1 (1)
FLANKING SEQUENCE (GENOMIC)
TGTCAAAGCAGACAGCGCAACAGAAGGACCATCTCTGATTTAAGTGAAAACTTATGGTTAATATCCACATTATGAGTAACATGTTGTGCAATAGGAAGGCTTTAAAGGTCATCCATAGATGACAATAAAAAGATACAAGCTTGCTTTCTATTATAAGTAACATTAGGCTAATCGTTTTGAAACAAAGTAAGTAAATGTAAACTTTATGTAACTTATTGTAGCATATAAATGGTGTGGGCTATTGCATTTCGTCTTTAAGACGATCTCACGTTACACATTAATAATAAACAACCCCAATGCACATGAATTTCTCTCATTTCATACTGACCCCCTGAACCCTTACCTTTACAGCAGACAGATGGAGGAGAGCCGCGAGAAATAACTGTATCAAATAAACAACCAAGTTCATGATTGTAATTCCAGTGGAGTGTTGCGGTGAGTCTCTGGCTCTCAAAACAATTAAGAAAGCGAAGCTGCTGGGTATGAATGAACCGAGTGTG
GGGTGCTATA/-
TCAAAGTAACACATCCATTCTGCCCTTCAGATCCGAAGCACCTGCGTCGAATCCGCTAAAATTAACTTCTGGACCGCCACCCGCTCCTCCAGAGAAAAAAAAAGGATATAAATAAGAATAACAATAATAATTATAATATAAAGAAAAGTGGAAATCCACACTATCTTGGTCCTCTGCGTAATTTAAAATTAAAATCCACAGTATAACGGAAAGCCGACGTTTAATGAATCTGAATCCAAAACGTCAGAGGCAAAACAAACAAAAAGTTTCGTCCACTTCCAAGCGCAGCCTCCAGTGTGCACGCGCGTCTATAGGGCCAGAGGACGGCTTCTGCGCATATGATTATCATCAAGAGCAAAGGCTTGCTGTAAAGTGATCCAGTGGCAATCCTTGGTTTGACCGCTGCACACGCGTCCGTTTTTTCCTCGTCTTATTTCCGTGACTGTTTTGGCTCGCGCTGGTTCGTACTGCCGTGGATGTTAACACGCGTACGGGAAGGT
OTHER bns301 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous vegfaabns301/bns301 vegfaa Unknown
Heterozygous vegfaabns301/+ vegfaa Unknown
Complex vegfaabns301/bns301 ; upf1ya3319/ya3319 upf1, vegfaa

CITATIONS  (1)