ZFIN ID: ZDB-CRISPR-190813-7
CRISPR Name: CRISPR1-vegfaa
Target: vegfaa (1)
Source:
Target Sequence:
5' - GTCAAACCAAGGATTGCCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-vegfaa No data available
GENOMIC FEATURES CREATED WITH CRISPR1-vegfaa
Genomic Feature Affected Genomic Regions    
bns301 vegfaa    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-vegfaa No data available
PHENOTYPE
Phenotype resulting from CRISPR1-vegfaa
No data available

Phenotype of all Fish created by or utilizing CRISPR1-vegfaa
Genome Resources:
CITATIONS (1)