Genomic Feature

ya347

ID
ZDB-ALT-190228-4
Name
ya347
Synonyms
  • 11 bp deletion (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Nicoli Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 17: 31449809 - 31449819 (GRCz11) (1) Details
Nucleotide change
TCACGAAGGCT/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
None
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
CACAACCATCTCTAGGGTTTACAGAGAATGGTCAAAACAGAGAAAAATATTCAGGGAACAGCAGTTCTGTGGGTGCAAATGTTTTGCTGATGCCAGAGGTCAGAGGAGAATGGCAAGACTGGTTTGAGCTGATAGAAAGACAACAGTAACTCAAATAACCACTCGTTACAAGCGAGGTGTGCAGAAGACCACACTGAGTGCCACTCCTGTCAGCTAAGAACAGGAAGGCAAAAGTGGGTCCAACCTGGTACTAGTAAGGTGGACCTTTTAAAGTGGCTGGTGAGAGTATTTTTAAAATGTATTAAATTAGCAAAACAGTTCTTTTAAATGTTTTCATATTTCACAGTTTGCTTTTAAAATGCAATAATTGCGAGAAATCTGCTAATAGATGGAGGCTTGAGTCAACACATGTAGAGCTGAAGAACCTCAATCTCACCTGTCGCTTTCTTGTTCTTTGATTGTAAGGTCAATGGGTTTGATGTCGGTAGAGTCGGTGTGCT
TCACGAAGGCT/- GATATGTTTCCAGCGTGTGGCTCTGGTTGAAAGCGAGCGAGTTGGAGATGACAAAATGGCCCACTGCTGAGAACTACAGGACTGGTCATGTGGAAACTACATCTGCCTGCAGACAGATGACTGGAGCTGGGCTTCAGCAGCAGAAAATGTCCTGGTGAAACACAGGATAGTCTTACTACTTTCAATGATTAAACTGAACTAATTGAACAAAAAAGCTCTGTGCACAATATATTTTTTTAAGATACGTAAAGGGAAAGATCACCTACAAATGAACATTTGAAGAGTTCAGATGGCAGAGATAGCTAAATGACATTAAAAATATTCTTCTAAAACATACAGTTTTCTTAGACTCTTGTGTCTGTGTTCAGTAATTTCACTTTTATGATGATGAATAGCTTCTTTTCCACTTAACTACTGAACATAGACATAGGAGGCATTTTCCATATGGTTTTTGCATCTGACCTCTTAATTTTTTCATCATTTTTTCACCTTAAAGTGGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations