header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181106-11
Genomic Feature: ihb289
Synonyms:
Affected Genomic Regions: bbc3 (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR1-bbc3
Lab Of Origin: Yonghua Sun Lab
Location: Chr 15: 23759139 - 23759145 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS No data available
FLANKING SEQUENCE (GENOMIC)
TTGTCACTGTAAATTACACAGTACATAATGTCTCAATATATTTTTCCGGCACTAACTCATAAATCTTCACTTCCACTTGTCAGAAATTAATGCAAATTAGTGCATGTTTAATTAAATACTGCTAAAACTCCAGTTGTAAACAAAACATTTTTTTTAATTAGATTTTTTTAGGTAAATGCAGCTTTATTCGCCAGCAATGTTTTGCACTAACACTTGGAGTCAAAGCCAGGGATTCTGTCTTCTGAATCTCATTTAAATAAATGATGCTAATTATGCACAGCATGCACATATTAATTCAGTGTGTTCAGCATGTTACCTGAATTGTCCCTGAGTAGACTGTCCTGCTGCTGGACGCTGTCCAAGCTGAAGGCATCATGTGAGGGGATGTGGGGCAGTGGTGCAGAGAGAGTGCTGGTTTGAGTGGCAATGGTTCGGCGTCGATGGCAGGGCTGGATGATGCTGCCATTTGGCCAGGCGTCCTGACGCAGCACCTCCATCCT
GCAGCTG/CCACCTCCA
TTCGGCGTGCCAGAGTTATGTTCGTCCACTCTGCTTTCCATCTCTGGTCGGGCCATTCCACATACAGTCTTGAAAGGAGAAAAACAAACAAAATGTTACACAAAATCATCAGACCTGTTTGCATGCCAACTGTTTCGTCTAAAACTGCAGTTGGACTCAAAAGACAACATATGCTGTTGCAAAGAAGAGACCTGTTAAAAAGTTATACTCGTTAAAAAATACATTTTTATTCAGATGTAAGTGAAAAGAAACTTAATAATAACATAATAAAAAGATAATCATTATAATAAGATAATGATAATACAATTTATGTAAATGAACATAATAAAAATTGCATTATAACTACAGTATTTATTTATCTTTGTAAATGTTACTTAAAGAAAATAAGGTTGTTAGTTCTTGTTAACTCACAGTGCTTTAACTAATGCTCTCAAGTACTTTGGATTTTAATAATGCATTAGTAAATGTTGAACTGTGAATATTACATTCTAATCATTCTT
OTHER ihb289 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)