ZFIN ID: ZDB-ALT-180910-3
Genomic Feature: zf1091
Synonyms: -2 (1)
Affected Genomic Regions: vegfaa (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN2-vegfaa
Lab Of Origin:
Location: Chr 16: 4317263 - 4317265 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 2 bp deleted (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
GGATGACGCGTTACTGCACGTAACATCTCACATATAGTGATATCTCACCAAATCCTTCGCTTAAGTGAGATTAAACCTTAGGATAGCAGCAGTCCCATACTATTGTTAGCCTATAAATATTCCTGTCAAAGCAGACAGCGCAACAGAAGGACCATCTCTGATTTAAGTGAAAACTTATGGTTAATATCCACATTATGAGTAACATGTTGTGCAATAGGAAGGCTTTAAAGGTCATCCATAGATGACAATAAAAAGATACAAGCTTGCTTTCTATTATAAGTAACATTAGGCTAATCGTTTTGAAACAAAGTAAGTAAATGTAAACTTTATGTAACTTATTGTAGCATATAAATGGTGTGGGCTATTGCATTTCGTCTTTAAGACGATCTCACGTTACACATTAATAATAAACAACCCCAATGCACATGAATTTCTCTCATTTCATACTGACCCCCTGAACCCTTACCTTTACAGCAGACAGATGGAGGAGAGCCGCGAGA
CG/-
AACTGTATCAAATAAACAACCAAGTTCATGATTGTAATTCCAGTGGAGTGTTGCGGTGAGTCTCTGGCTCTCAAAACAATTAAGAAAGCGAAGCTGCTGGGTATGAATGAACCGAGTGTGATATCGTGGGTCAAAGTAACACATCCATTCTGCCCTTCAGATCCGAAGCACCTGCGTCGAATCCGCTAAAATTAACTTCTGGACCGCCACCCGCTCCTCCAGAGAAAAAAAAAGGATATAAATAAGAATAACAATAATAATTATAATATAAAGAAAAGTGGAAATCCACACTATCTTGGTCCTCTGCGTAATTTAAAATTAAAATCCACAGTATAACGGAAAGCCGACGTTTAATGAATCTGAATCCAAAACGTCAGAGGCAAAACAAACAAAAAGTTTCGTCCACTTCCAAGCGCAGCCTCCAGTGTGCACGCGCGTCTATAGGGCCAGAGGACGGCTTCTGCGCATATGATTATCATCAAGAGCAAAGGCTTGCTGTA
OTHER zf1091 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Complex s843Tg ; vegfaazf1091/zf1091 vegfaa

CITATIONS  (1)