ZFIN ID: ZDB-ALT-180910-2
Genomic Feature: zf1090
Synonyms: -7 (1)
Affected Genomic Regions: vegfaa (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN2-vegfaa
Lab Of Origin:
Location: Chr 16: 4317261 - 4317269 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 7 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
CCGGATGACGCGTTACTGCACGTAACATCTCACATATAGTGATATCTCACCAAATCCTTCGCTTAAGTGAGATTAAACCTTAGGATAGCAGCAGTCCCATACTATTGTTAGCCTATAAATATTCCTGTCAAAGCAGACAGCGCAACAGAAGGACCATCTCTGATTTAAGTGAAAACTTATGGTTAATATCCACATTATGAGTAACATGTTGTGCAATAGGAAGGCTTTAAAGGTCATCCATAGATGACAATAAAAAGATACAAGCTTGCTTTCTATTATAAGTAACATTAGGCTAATCGTTTTGAAACAAAGTAAGTAAATGTAAACTTTATGTAACTTATTGTAGCATATAAATGGTGTGGGCTATTGCATTTCGTCTTTAAGACGATCTCACGTTACACATTAATAATAAACAACCCCAATGCACATGAATTTCTCTCATTTCATACTGACCCCCTGAACCCTTACCTTTACAGCAGACAGATGGAGGAGAGCCGCGA
AGCCGCG/-
GTATCAAATAAACAACCAAGTTCATGATTGTAATTCCAGTGGAGTGTTGCGGTGAGTCTCTGGCTCTCAAAACAATTAAGAAAGCGAAGCTGCTGGGTATGAATGAACCGAGTGTGATATCGTGGGTCAAAGTAACACATCCATTCTGCCCTTCAGATCCGAAGCACCTGCGTCGAATCCGCTAAAATTAACTTCTGGACCGCCACCCGCTCCTCCAGAGAAAAAAAAAGGATATAAATAAGAATAACAATAATAATTATAATATAAAGAAAAGTGGAAATCCACACTATCTTGGTCCTCTGCGTAATTTAAAATTAAAATCCACAGTATAACGGAAAGCCGACGTTTAATGAATCTGAATCCAAAACGTCAGAGGCAAAACAAACAAAAAGTTTCGTCCACTTCCAAGCGCAGCCTCCAGTGTGCACGCGCGTCTATAGGGCCAGAGGACGGCTTCTGCGCATATGATTATCATCAAGAGCAAAGGCTTGCTGTAAAGT
OTHER zf1090 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous vegfaazf1090/zf1090 (AB) vegfaa ♀+/- ♂+/-
vegfaazf1090/zf1090 vegfaa ♀+/- ♂+/-
Complex la116Tg ; sd7Tg ; vegfaazf1090/zf1090 vegfaa
la116Tg ; vegfaazf1090/zf1090 vegfaa
s843Tg ; vegfaazf1090/zf1090 vegfaa
vegfaazf1090/zf1090 ; f2Tg vegfaa

CITATIONS  (2)