Genomic Feature

el506

ID
ZDB-ALT-180628-7
Name
el506
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Crump Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 18: 23874654 - 23874661 (GRCz11) (1) Details
Nucleotide change
CAATGGGA/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted from position 725 to 732 in RefSeq:NM_131183.1 in Exon 1 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
at position 128 (1)
Sequences
Flanking Sequence
TTGTGGTCGATCTGGAGTCCCTAGCTTAGTGTGTGTGTATGTGAGCGCGCGTGTGTGTATATGTGATTTTGACGCTGCTTCTCCATACTCCCTCGCCATAACCGCACGGCATATCTGCAGTGATTATAAAAATAAAGACAAATACCCATGTTTTCGTCGCCTAATAAAAGCAATGGTTAGTTTAAAGCTGCGAACATGTGCAATGCGAAATAGTCGCTAAGGAGAGGGTGTTCTTTATTCGAGCATTAAGGGCGCCGTGATAACGCTCAGTCTCGAGCGCTATAGGCGGTTCCTTCGCATGCTGTGGACGGGCAGATTGAGAGAGAGGAGTCGGGGATAAAATACAGGAAGAAGCATGCGCGATTAAGTCAGGCTAAATACAGAAGACAAAGACAAAGACAGCAGTAAAACAACAAAAATCCGAATACCTTCCCGTCTCATGCCAACTTTGAGGCATTTTTTGAGGCGGCAGTACTGACACTGATTGCGATGGTGCTGGT
CAATGGGA/- CAATTCCTGTTGGCACGGCATGTGTAAGTGAGGTTCCTTCGTACGCTCCGTTTGAAAAAGCTTTTGCACCCCTCGCAAGTGAACTGGCCATAGTGTTTACCGCTGGATTTGTCCCCGCAAACCACGCACTCTATATGCTGTGGCTGCTGCTTTTCCGACTGGCTCTGCGTCGTCTGGTTCGTCGGGGTTGACTGTGTGTTGTTATTGTTGTTCGGGGGTCCTTGAACGGGTGTCTGAGGGGTCGGAGGGGCAACCTGAGAGGCCGTCAGACCCAGCTGGCCTGGTTGAGGGGTCGGAAGGGATAGTCCTCCTTGGGTTTGCGATGAGAGGGTGCCATGGGTCTCGGCCACATCGTCCTGGGAGCCTCTCCACACTACCATTGCCATATCTATCAGTCAACGTTAAAAAAACTTTTTGTTCCCCGTTTTTGGTTTCGGAATGCTTTGTTTAAAAAAATAATATCGCAGCACGGTGCCTCTATCACTTAGGAGGGTAAAATA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations