Genomic Feature

ouc2003

ID
ZDB-ALT-180411-1
Name
ouc2003
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Chengtian Zhao Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 8: 54076709 - 54076713 (GRCz11) (1) Details
Nucleotide change
CAGTG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
at position 315 (1)
Sequences
Flanking Sequence
TTTTTATTGTTACGTTGCCTTGAATACATGCCTCTACAATCACAACAAAGCCAGTATAAGGAGTCCAGCAGTAAGAGAGTTAAGATGTGTTTCCTTCTGCTGCGTTTTAGGAGGAGAGAACAGGAAGGATCTTATGCACCGTTACGCTGGACTCGCTGGATGATGTACTGAAACCAGAACAGGGTCTGTCCTCTCTCAAAACTGTCTTTTGGTTGAACCAATTGGGTTTTGTAAAAATACAAAAAGGAAAACTGACAGACATTTTTTTCTGCAAGTGGTAGCGGTCGCTCGTTTCCCTGGGCTGAGCGCTTCGTGGTCTCTGTGTGGTTTGCCGTGGGAGCCCAGTGCAGGTCGCTGCTTCGAGAGTGTCTGGAAGGAGAGTTTACGCCGGAGACACGGAGCTGGAAGACACGGACGAAGCCTCGGTCTTGGAGGCGGTGGTGGAGGCGCCCTCTTCCTCTTCGAAGGGGTTCTTGCCGCAGCACAGGGTGGTGATCATG
CAGTG/- ACGGAACTGCTTGTTCATGCAGATGTAGATGCAGGGGTTGTAGACGGCGGACGTCTTGGCGAAGAAGGCGGGCAGGGTCATGAAGACGGGCCCGAACTCGCTGCCCTGGTGGGTGAAGATGTACCAGGCCACGCCGGCGTAGGGCAACCAGCAGATGAGGAAGGCGATGACCATGATGATGACCATGCGGGTGACCTCGCGCTCGGCCCGCTGTGTGGTCTCGGACTCCTGCTGCTGCGCTGCCGCCTCCTTCACAGTGCACACCAGCCGGCCATAGCAGAAGAAGATGACTATCAGTGGGATGAAGAAGTGCACGATGAACATGTAGATGACGAAGGACTCGTTGTTGACACCGGGAGTGCGGGTGTAGTAGTCGACGCCGCAGGAGCACTGCATGCCCTCGGGGATGTAACGCGACCAGCCCACCAGTGGCGGCACGGCACAGGAGCAGGCCATGACCCAGGTGAAGGCCACCCCCATGATGGCATGGTTCTCCCCGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations