CRISPR

CRISPR11-rho

ID

ZDB-CRISPR-180328-3

Name

CRISPR11-rho

Previous Names

None

Target

rho (1)

Sequence

5' - TCACTGCATGATCACCACCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ouc2003	rho

Expression

Gene expression in Wild Types + CRISPR11-rho

No data available

Phenotype

Phenotype resulting from CRISPR11-rho

No data available

Phenotype of all Fish created by or utilizing CRISPR11-rho

Phenotype	Fish	Conditions	Figures
retinal rod cell photoreceptor outer segment ab5-rho labeling decreased amount, abnormal	rho^{ouc2003/ouc2003}	standard conditions	Fig. 6 from Feng et al., 2017
retinal rod cell photoreceptor outer segment decreased amount, abnormal	rho^{ouc2003/ouc2003}	standard conditions	Fig. 6 from Feng et al., 2017
retinal rod cell plasma membrane ab5-rho labeling mislocalised, abnormal	rho^{ouc2003/ouc2003}	standard conditions	Fig. 6 from Feng et al., 2017
retinal rod cell retinal photoreceptor layer decreased thickness, abnormal	rho^{ouc2003/ouc2003}	standard conditions	Fig. 6 from Feng et al., 2017
retinal cone cell degenerate, abnormal	rho^{ouc2003/ouc2003}	standard conditions	Fig. 6 from Feng et al., 2017
whole organism pde6gb expression amount, ameliorated	kif3a^{ouc2004/ouc2004}; rho^ouc2003/+	standard conditions	Fig. 7 from Feng et al., 2017
whole organism pde6a expression amount, ameliorated	kif3a^{ouc2004/ouc2004}; rho^ouc2003/+	standard conditions	Fig. 7 from Feng et al., 2017
whole organism gngt1 expression amount, ameliorated	kif3a^{ouc2004/ouc2004}; rho^ouc2003/+	standard conditions	Fig. 7 from Feng et al., 2017
whole organism gnat1 expression amount, ameliorated	kif3a^{ouc2004/ouc2004}; rho^ouc2003/+	standard conditions	Fig. 7 from Feng et al., 2017
whole organism rho expression amount, ameliorated	kif3a^{ouc2004/ouc2004}; rho^ouc2003/+	standard conditions	Fig. 7 from Feng et al., 2017
whole organism gngt1 expression amount, ameliorated	kif3a^{ouc2004/ouc2004}; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
whole organism pde6a expression amount, ameliorated	kif3a^{ouc2004/ouc2004}; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
whole organism gnat1 expression amount, ameliorated	kif3a^{ouc2004/ouc2004}; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
whole organism rho expression amount, ameliorated	kif3a^{ouc2004/ouc2004}; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
whole organism pde6gb expression amount, ameliorated	kif3a^{ouc2004/ouc2004}; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
whole organism pde6a expression amount, ameliorated	kif3b^jj203/jj203; rho^ouc2003/+	standard conditions	Fig. 7 from Feng et al., 2017
whole organism gnat1 expression amount, ameliorated	kif3b^jj203/jj203; rho^ouc2003/+	standard conditions	Fig. 7 from Feng et al., 2017
whole organism gngt1 expression amount, ameliorated	kif3b^jj203/jj203; rho^ouc2003/+	standard conditions	Fig. 7 from Feng et al., 2017
whole organism rho expression amount, ameliorated	kif3b^jj203/jj203; rho^ouc2003/+	standard conditions	Fig. 7 from Feng et al., 2017
whole organism pde6gb expression amount, ameliorated	kif3b^jj203/jj203; rho^ouc2003/+	standard conditions	Fig. 7 from Feng et al., 2017
whole organism gnat1 expression amount, ameliorated	kif3b^jj203/jj203; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
whole organism pde6a expression amount, ameliorated	kif3b^jj203/jj203; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
whole organism gngt1 expression amount, ameliorated	kif3b^jj203/jj203; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
retinal rod cell degenerate, ameliorated	kif3b^jj203/jj203; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
retinal rod cell rho expression amount, ameliorated	kif3b^jj203/jj203; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
whole organism rho expression amount, ameliorated	kif3b^jj203/jj203; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
retinal rod cell photoreceptor outer segment absent, abnormal	kif3b^jj203/jj203; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017
whole organism pde6gb expression amount, ameliorated	kif3b^jj203/jj203; rho^{ouc2003/ouc2003}	standard conditions	Fig. 7 from Feng et al., 2017

Citations