ZFIN ID: ZDB-ALT-180129-12
Genomic Feature: sdu15
Synonyms:
Affected Genomic Regions: dvl2 (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-dvl2
Lab Of Origin: De-Li Shi Lab
Location: Chr 7: 20260682 - 20260686 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 5 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TGGCCCGAGCCGAAGAGAAGTATTTCAAACCCCCATGTGTTTTTGTAGGGGGGGATGTTGTTACAGGATAGCTGGCCGTAGGTGTGTTTTTAACATTTTAGGAAACTAAATCATGAGAATCGACATTGTCCAAGAGAGCAAAAGTTAGACACAACAGAGCAGTTTTCTTTGTTTTTGCTGGATGCTGTGGCCCGGGCAGTGTTATCGGATAGTAGTATTGTGGTCTAGACGACTTTCCTCAACCCCCTTCTCTCCGGAGCGCTGGCTAGCGTTAGCAGGATAAGTTAGCCGCTACCTCTTCCATACTTTCGCAGAACAACGGGAAAGTTTAGCAGGGTTGAGAGACATGGCGGAGACCAAGATAATTTATCACATTGACGAAGAGGAGACGCCGTACTTGGTGAAGATTCCCATAGCGGCCGAGAAAATCACTTTGCTGGATTTTAAGCAGGTCTTGAACAAGCCGAACTACAAATTCTTCTTCAAGTCTATGGACCAGG
ACTTC/-
GGGTAAGTGATTGTGGGGCCAAAAAACGCACAAAGATGCACGAGAAGTCGAATAAAAGTGATTTTCTTTTACTGTAGGAAAGATATCATTGCTTAATTTGTGTCAAAAGTTGTTGTGAAGGAGTTTTATGGGTTTTCCCTAGACAAGGACACTGGTCTGGGTGGTCTGTTAATCGTATCAAGCCATCATCGCAAAGTAAAAGTGTGTGTCCAAAAGTGTCGATTAAGTTGATCACTTTCTGCAGTCTCTGACTTTACAGTTTTGTATAAAAAAAAACTACAAAAGTTGTTCATAGTTGTGTTGTGTACATGTGTGACGTATGTATGCATAATAAGCTACTGTTTTGCATCTGGACTTATACAGTCAGTAGAGTCATGACATTATTTAAAGGCTAATGTATGAATGGAGCCTATTTTCTCAAAACACTTCACTTTAATATACGCCACATTCAAATTTTAATTAATTATTGTATTATATGAATTTTAAACTTAATCAAAAGT
Comment Citation
5bp deletion from position 154bp to 159bp after ATG Zebrafish Nomenclature Committee
OTHER sdu15 PAGES No links to external sites

CITATIONS  (2)