Genomic Feature

ioz3

ID
ZDB-ALT-160817-6
Name
ioz3
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Liu Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 2: 879750 - 879756 (GRCz11) (1) Details
Nucleotide change
TTTGCCA/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
7 bp deleted in Exon 1 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
ATTTTAGGGTGAACTAACCCTTTAAGACAACCATCCTCCACCTGTAACCGCTTCTCTTTTCATTTTTAACACTGAATCTTATTGTTTAATAAAGATAAACACCAACAACAGTCGGTTTGTGAATCTTTTTGACAAGAAAATGCTTATATTGTTTAGAAAAATGCTGATTCGTAACTCAATATTCGGTTAATTCGTTATTCAACGGTCATTCATATTTGATCCAACATTGGCTAAAAACAACCCAGTATAACCATAATCAAGTTTAAAATAGTTATGTAGACAGTGTTTTGAGTTTCAAATATAGTAAATAGTTTCTGAGGCGTGATTATACTCAGATAAACATCATTAATCACCTTGAAGAGAGCGGCGTCCTCATCGCGGTTGTAGTCCTGTTTTCCCGCGTGTTTCCATGGAATCCTGAAAATGGTTTTCTCGTCATTTTCCCAAACCAATCCGGAATACTCCCCGCTGTCAATCTGCTCGATGAGCCACTGTCTAAG
TTTGCCA/- TTCCCACAACTGACTGACATGATGCAGTCCCCATCTAAGTTCATGTCTGTGCGGAGCAGGTGCACATGCAGAAAGCAGATGAGTGCGTGCATGCAAAATAATACTCAATAATAATCACAATCATAACACAAGTGAGACGAGCAGATGAAGAGGCAACTAAAAACAATAAAGTGTGCATGCGTTTAATAGGCTACATTAAAAGCAAATTAATCTAAAACATGTCTAAAAGCGTGCGTTATGCAAATTATATCACATCGTGTAGCGCATTAATACACAACACAGATGTTTGTTCTGATTAAAATAAAGTCTTACCTTAGTGAATGCAATGCAGCTCGACTTGACTTTGAAAACAGACTCTTCTCAAGTCAAAGTACTTAAATGATGTAGGTGGAGATGGGTGGAGCTTTACGTGGAAGAGATTTTCTCCAGCAGCATTAAAGATCCGGAGACTTCAGAGAAACGCGGCAGAACCGCAATAAACAGACAGCATGCGGGAAATC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations